Gene Page: KIF2A
Summary ?
GeneID | 3796 |
Symbol | KIF2A |
Synonyms | CDCBM3|HK2|KIF2 |
Description | kinesin heavy chain member 2A |
Reference | MIM:602591|HGNC:HGNC:6318|HPRD:03996| |
Gene type | protein-coding |
Map location | 5q12-q13 |
Pascal p-value | 0.01 |
Fetal beta | 0.505 |
DMG | 1 (# studies) |
Support | STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg27058811 | 5 | 61603122 | KIF2A | 5.8E-8 | -0.014 | 1.48E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AGA | 0.44 | 0.44 |
KLRC2 | 0.42 | 0.46 |
LHPP | 0.41 | 0.48 |
SFT2D1 | 0.41 | 0.50 |
EFEMP1 | 0.40 | 0.41 |
HP | 0.40 | 0.34 |
TLR4 | 0.40 | 0.38 |
SLC35D2 | 0.40 | 0.45 |
CBR1 | 0.40 | 0.48 |
CRYL1 | 0.39 | 0.45 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
CHD3 | -0.30 | -0.31 |
AL033532.1 | -0.30 | -0.28 |
SOX11 | -0.30 | -0.30 |
GPR161 | -0.30 | -0.27 |
ZNF551 | -0.30 | -0.30 |
SLCO5A1 | -0.30 | -0.31 |
AKAP13 | -0.30 | -0.30 |
USP49 | -0.30 | -0.30 |
XKR7 | -0.30 | -0.31 |
SETBP1 | -0.29 | -0.33 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003777 | microtubule motor activity | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
GO:0007018 | microtubule-based movement | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005813 | centrosome | IEA | - | |
GO:0005874 | microtubule | IEA | - | |
GO:0005875 | microtubule associated complex | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID PLK1 PATHWAY | 46 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
REACTOME MHC CLASS II ANTIGEN PRESENTATION | 91 | 61 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE MITOTIC | 325 | 185 | All SZGR 2.0 genes in this pathway |
REACTOME MITOTIC M M G1 PHASES | 172 | 98 | All SZGR 2.0 genes in this pathway |
REACTOME FACTORS INVOLVED IN MEGAKARYOCYTE DEVELOPMENT AND PLATELET PRODUCTION | 132 | 101 | All SZGR 2.0 genes in this pathway |
REACTOME KINESINS | 24 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME DNA REPLICATION | 192 | 110 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME MITOTIC PROMETAPHASE | 87 | 51 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2A DN | 141 | 84 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF DN | 228 | 137 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION DN | 84 | 54 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
SEIDEN MET SIGNALING | 19 | 16 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q | 116 | 71 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
YAGI AML FAB MARKERS | 191 | 131 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
RAMALHO STEMNESS UP | 206 | 118 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 12 | 36 | 18 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D2 | 41 | 30 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
DURCHDEWALD SKIN CARCINOGENESIS UP | 88 | 47 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN UP | 181 | 112 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS UP | 170 | 107 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION C | 69 | 49 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 36HR DN | 185 | 116 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G3 UP | 188 | 121 | All SZGR 2.0 genes in this pathway |
RAGHAVACHARI PLATELET SPECIFIC GENES | 70 | 46 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 405 | 411 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-1/206 | 528 | 534 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-101 | 569 | 575 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-124/506 | 473 | 479 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-144 | 569 | 575 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-203.1 | 131 | 138 | 1A,m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-338 | 665 | 671 | 1A | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
miR-377 | 592 | 598 | m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-488 | 696 | 702 | 1A | hsa-miR-488 | CCCAGAUAAUGGCACUCUCAA |
miR-494 | 219 | 225 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.