Gene Page: RHOC
Summary ?
GeneID | 389 |
Symbol | RHOC |
Synonyms | ARH9|ARHC|H9|RHOH9 |
Description | ras homolog family member C |
Reference | MIM:165380|HGNC:HGNC:669|Ensembl:ENSG00000155366|HPRD:01322|Vega:OTTHUMG00000011905 |
Gene type | protein-coding |
Map location | 1p13.1 |
Pascal p-value | 0.001 |
Sherlock p-value | 0.285 |
Fetal beta | -0.168 |
DMG | 1 (# studies) |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04859477 | 1 | 113249989 | RHOC | 9.66E-8 | -0.009 | 2.16E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
POM121 | 0.89 | 0.91 |
GBF1 | 0.89 | 0.89 |
CRTC3 | 0.89 | 0.91 |
ELMO2 | 0.89 | 0.90 |
GGA3 | 0.88 | 0.90 |
SYVN1 | 0.88 | 0.89 |
UPF1 | 0.88 | 0.91 |
POM121C | 0.88 | 0.89 |
AC069234.1 | 0.88 | 0.88 |
RPAP1 | 0.87 | 0.91 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.72 | -0.78 |
AF347015.31 | -0.68 | -0.68 |
MT-CO2 | -0.67 | -0.68 |
C1orf54 | -0.66 | -0.74 |
AF347015.27 | -0.63 | -0.64 |
AF347015.8 | -0.63 | -0.65 |
HIGD1B | -0.62 | -0.62 |
GNG11 | -0.62 | -0.65 |
MT-CYB | -0.62 | -0.61 |
IFI27 | -0.61 | -0.59 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004871 | signal transducer activity | IMP | 12761501 | |
GO:0003924 | GTPase activity | TAS | 8468062 | |
GO:0005515 | protein binding | IPI | 15670823 |17353931 | |
GO:0005525 | GTP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
GO:0043123 | positive regulation of I-kappaB kinase/NF-kappaB cascade | IMP | 12761501 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID PRL SIGNALING EVENTS PATHWAY | 23 | 17 | All SZGR 2.0 genes in this pathway |
PID CXCR4 PATHWAY | 102 | 78 | All SZGR 2.0 genes in this pathway |
PID P75 NTR PATHWAY | 69 | 51 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA1213 SIGNALLING EVENTS | 74 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME SEMA4D IN SEMAPHORIN SIGNALING | 32 | 22 | All SZGR 2.0 genes in this pathway |
REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME SEMA4D INDUCED CELL MIGRATION AND GROWTH CONE COLLAPSE | 27 | 21 | All SZGR 2.0 genes in this pathway |
WINTER HYPOXIA UP | 92 | 57 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
HUMMERICH SKIN CANCER PROGRESSION UP | 88 | 58 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
BORLAK LIVER CANCER EGF UP | 57 | 41 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM2 | 153 | 102 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM3 | 70 | 37 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
DER IFN ALPHA RESPONSE UP | 74 | 48 | All SZGR 2.0 genes in this pathway |
DER IFN BETA RESPONSE UP | 102 | 67 | All SZGR 2.0 genes in this pathway |
SANA RESPONSE TO IFNG DN | 85 | 56 | All SZGR 2.0 genes in this pathway |
DER IFN GAMMA RESPONSE UP | 71 | 45 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
FAELT B CLL WITH VH REARRANGEMENTS UP | 48 | 34 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
NEMETH INFLAMMATORY RESPONSE LPS UP | 88 | 64 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
VERRECCHIA RESPONSE TO TGFB1 C2 | 25 | 18 | All SZGR 2.0 genes in this pathway |
VERRECCHIA EARLY RESPONSE TO TGFB1 | 58 | 43 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO CANTHARIDIN DN | 69 | 46 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
EHLERS ANEUPLOIDY UP | 41 | 29 | All SZGR 2.0 genes in this pathway |
NUTT GBM VS AO GLIOMA UP | 46 | 34 | All SZGR 2.0 genes in this pathway |
CHANG CORE SERUM RESPONSE UP | 212 | 128 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS DN | 116 | 74 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
LINSLEY MIR16 TARGETS | 206 | 127 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-138 | 263 | 270 | 1A,m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-142-5p | 270 | 277 | 1A,m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-17-5p/20/93.mr/106/519.d | 268 | 275 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-93.hd/291-3p/294/295/302/372/373/520 | 267 | 273 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.