Summary ?
GeneID389384
SymbolC6orf222
Synonyms-
Descriptionchromosome 6 open reading frame 222
ReferenceHGNC:HGNC:33769|Ensembl:ENSG00000189325|HPRD:16824|Vega:OTTHUMG00000014591
Gene typeprotein-coding
Map location6p21.31
Pascal p-value0.184
Fetal beta-0.653
SupportCompositeSet

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DNM:Fromer_2014Whole Exome Sequencing analysisThis study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 

Section I. Genetics and epigenetics annotation

@DNM table

GeneChromosomePositionRefAltTranscriptAA changeMutation typeSiftCG46TraitStudy
C6orf222chr636294377CTNM_001010903p.316V>ImissenseSchizophreniaDNM:Fromer_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681420All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP D 280158All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682433All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-33815321538m8hsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-378145414611A,m8hsa-miR-378CUCCUGACUCCAGGUCCUGUGU