Gene Page: SAMD5

Summary
GeneID  389432
Symbol  SAMD5
Synonyms  dJ875H10.1
Description  sterile alpha motif domain containing 5
See related  HGNC:21180|Ensembl:ENSG00000203727|
Locus tag  RP5-875H10.1
Gene type  protein-coding
Map location  6q24.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.428 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
LIU_PROSTATE_CANCER_UP 9657All SZGR genes in this pathway
TURASHVILI_BREAST_DUCTAL_CARCINOMA_VS_DUCTAL_NORMAL_DN 198110All SZGR genes in this pathway
VECCHI_GASTRIC_CANCER_EARLY_UP 430232All SZGR genes in this pathway
DAWSON_METHYLATED_IN_LYMPHOMA_TCL1 5945All SZGR genes in this pathway
GARCIA_TARGETS_OF_FLI1_AND_DAX1_DN 176104All SZGR genes in this pathway
SCHAEFFER_PROSTATE_DEVELOPMENT_6HR_DN 514330All SZGR genes in this pathway
SCHAEFFER_PROSTATE_DEVELOPMENT_48HR_DN 428306All SZGR genes in this pathway
WANG_SMARCE1_TARGETS_UP 280183All SZGR genes in this pathway
RIGGI_EWING_SARCOMA_PROGENITOR_UP 430288All SZGR genes in this pathway
GABRIELY_MIR21_TARGETS 289187All SZGR genes in this pathway
TERAO_AOX4_TARGETS_SKIN_DN 2715All SZGR genes in this pathway
ZWANG_TRANSIENTLY_UP_BY_2ND_EGF_PULSE_ONLY 1725838All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-14546521Ahsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-324-3p874880m8hsa-miR-324-3pCCACUGCCCCAGGUGCUGCUGG
hsa-miR-324-3pCCACUGCCCCAGGUGCUGCUGG
miR-505201720231Ahsa-miR-505GUCAACACUUGCUGGUUUCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.