Gene Page: L1CAM
Summary ?
GeneID | 3897 |
Symbol | L1CAM |
Synonyms | CAML1|CD171|HSAS|HSAS1|MASA|MIC5|N-CAM-L1|N-CAML1|NCAM-L1|S10|SPG1 |
Description | L1 cell adhesion molecule |
Reference | MIM:308840|HGNC:HGNC:6470|Ensembl:ENSG00000198910|HPRD:02394|Vega:OTTHUMG00000024221 |
Gene type | protein-coding |
Map location | Xq28 |
Sherlock p-value | 0.631 |
Fetal beta | -0.293 |
eGene | Myers' cis & trans |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_mGluR5 G2Cdb.humanNRC CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.019 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16829545 | chr2 | 151977407 | L1CAM | 3897 | 0.01 | trans | ||
rs16955618 | chr15 | 29937543 | L1CAM | 3897 | 0.04 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 1769655 |
GO:0007155 | cell adhesion | NAS | 7920659 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ANK1 | ANK | SPH1 | SPH2 | ankyrin 1, erythrocytic | - | HPRD,BioGRID | 11222639 |
ANK2 | DKFZp686M09125 | DKFZp686P0948 | FLJ38277 | LQT4 | ankyrin 2, neuronal | L1CAM interacts with Ankyrin. This interaction was modelled on a demonstrated interaction between human L1CAM and drosophila ankyrin. | BIND | 15647482 |
ANK2 | DKFZp686M09125 | DKFZp686P0948 | FLJ38277 | LQT4 | ankyrin 2, neuronal | - | HPRD | 9832558 |
AP2A1 | ADTAA | AP2-ALPHA | CLAPA1 | adaptor-related protein complex 2, alpha 1 subunit | Affinity Capture-Western | BioGRID | 12942088 |
AP2M1 | AP50 | CLAPM1 | mu2 | adaptor-related protein complex 2, mu 1 subunit | L1CAM interacts with AP-2 mu2 chain. This interaction was modelled on a demonstrated interaction between human L1CAM and AP-2 mu2 chain from an unspecified species. | BIND | 15647482 |
CNTN1 | F3 | GP135 | contactin 1 | - | HPRD,BioGRID | 7595520 |
CNTN2 | AXT | DKFZp781D102 | FLJ42746 | MGC157722 | TAG-1 | TAX | TAX1 | contactin 2 (axonal) | L1-CAM interacts with TAG-1. | BIND | 9837910 |
CNTN2 | AXT | DKFZp781D102 | FLJ42746 | MGC157722 | TAG-1 | TAX | TAX1 | contactin 2 (axonal) | - | HPRD,BioGRID | 12139915 |
EZR | CVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2 | ezrin | - | HPRD,BioGRID | 12070130 |
ITGA5 | CD49e | FNRA | VLA5A | integrin, alpha 5 (fibronectin receptor, alpha polypeptide) | - | HPRD,BioGRID | 10871287 |
ITGAV | CD51 | DKFZp686A08142 | MSK8 | VNRA | integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) | - | HPRD,BioGRID | 10871287 |
MSN | - | moesin | - | HPRD | 12070130 |
NCAM1 | CD56 | MSK39 | NCAM | neural cell adhesion molecule 1 | - | HPRD | 8509458 |10611478 |
NCAN | CSPG3 | FLJ44681 | neurocan | - | HPRD,BioGRID | 7513709 |10934197 |
NUMB | S171 | numb homolog (Drosophila) | - | HPRD,BioGRID | 12942088 |
PEA15 | HMAT1 | HUMMAT1H | MAT1 | MAT1H | PEA-15 | PED | phosphoprotein enriched in astrocytes 15 | Two-hybrid | BioGRID | 16169070 |
PRNP | ASCR | CD230 | CJD | GSS | MGC26679 | PRIP | PrP | PrP27-30 | PrP33-35C | PrPc | prion | prion protein | - | HPRD | 15146195 |
RANBP9 | RANBPM | RAN binding protein 9 | L1CAM interacts with RanBPM. | BIND | 16000162 |
RDX | DFNB24 | radixin | - | HPRD | 12070130 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
BIOCARTA EPHA4 PATHWAY | 10 | 8 | All SZGR 2.0 genes in this pathway |
PID INTEGRIN3 PATHWAY | 43 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME CELL SURFACE INTERACTIONS AT THE VASCULAR WALL | 91 | 65 | All SZGR 2.0 genes in this pathway |
REACTOME BASIGIN INTERACTIONS | 30 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
REACTOME INTERACTION BETWEEN L1 AND ANKYRINS | 23 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNAL TRANSDUCTION BY L1 | 34 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME RECYCLING PATHWAY OF L1 | 27 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
WILCOX RESPONSE TO PROGESTERONE DN | 66 | 44 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS UP | 290 | 177 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP | 204 | 140 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS E UP | 97 | 60 | All SZGR 2.0 genes in this pathway |
SEITZ NEOPLASTIC TRANSFORMATION BY 8P DELETION DN | 30 | 25 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
MURATA VIRULENCE OF H PILORI | 24 | 16 | All SZGR 2.0 genes in this pathway |
JAZAG TGFB1 SIGNALING UP | 108 | 69 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
LIN APC TARGETS | 77 | 55 | All SZGR 2.0 genes in this pathway |
SMITH TERT TARGETS DN | 87 | 69 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
HARRIS HYPOXIA | 81 | 64 | All SZGR 2.0 genes in this pathway |
MODY HIPPOCAMPUS NEONATAL | 35 | 25 | All SZGR 2.0 genes in this pathway |
NIELSEN SCHWANNOMA UP | 18 | 16 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
LEE METASTASIS AND ALTERNATIVE SPLICING UP | 74 | 51 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
MASRI RESISTANCE TO TAMOXIFEN AND AROMATASE INHIBITORS DN | 20 | 11 | All SZGR 2.0 genes in this pathway |
MCCABE HOXC6 TARGETS CANCER UP | 31 | 23 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
SASAI TARGETS OF CXCR6 AND PTCH1 UP | 13 | 9 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
YIH RESPONSE TO ARSENITE C5 | 10 | 7 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
ISSAEVA MLL2 TARGETS | 62 | 35 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS UP | 221 | 120 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-182 | 144 | 151 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-488 | 528 | 534 | 1A | hsa-miR-488 | CCCAGAUAAUGGCACUCUCAA |
miR-96 | 145 | 151 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.