SZGR2

Summary ?

GeneID	3899
Symbol	AFF3
Synonyms	LAF4\|MLLT2-like
Description	AF4/FMR2 family member 3
Reference	MIM:601464\|HGNC:HGNC:6473\|Ensembl:ENSG00000144218\|HPRD:03272\|Vega:OTTHUMG00000153011
Gene type	protein-coding
Map location	2q11.2-q12
Pascal p-value	0.028
Fetal beta	1.784
DMG	1 (# studies)
eGene	Caudate basal ganglia Cerebellum Cortex Frontal Cortex BA9 Hypothalamus
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
GSMA_I	Genome scan meta-analysis	Psr: 0.0004

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg11428546	2	100723110	AFF3	1.227E-4	0.533	0.03	DMG:Wockner_2014
cg25350306	2	100190218	AFF3	3.266E-4	0.54	0.04	DMG:Wockner_2014
cg11577355	2	100722474	AFF3	5.69E-4	0.318	0.049	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0007275	multicellular organismal development	TAS		8555498
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	TAS		8555498

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
GARY CD5 TARGETS DN	431	263	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP	380	215	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY DN	367	220	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP	194	122	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP	175	108	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN	284	156	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN	291	176	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A DN	90	61	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER DN	185	115	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW UP	162	104	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH DN	180	110	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA DN	181	107	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA PROGRESSION RISK	74	44	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH VS LOW DN	32	21	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX1 DN	10	7	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN	165	104	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN	371	218	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D UP	139	95	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
ZEMBUTSU SENSITIVITY TO NIMUSTINE	17	13	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	4074	4080	1A	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-129-5p	3964	3970	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	3964	3970	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-134	4065	4071	m8	hsa-miR-134^brain	UGUGACUGGUUGACCAGAGGG
miR-138	4069	4075	m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-145	3519	3525	1A	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-200bc/429	496	503	1A,m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-224	4101	4108	1A,m8	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-486	4086	4093	1A,m8	hsa-miR-486	UCCUGUACUGAGCUGCCCCGAG
miR-493-5p	4084	4090	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: AFF3