SZGR2

Summary ?

GeneID	3929
Symbol	LBP
Synonyms	BPIFD2
Description	lipopolysaccharide binding protein
Reference	MIM:151990\|HGNC:HGNC:6517\|Ensembl:ENSG00000129988\|HPRD:07175\|Vega:OTTHUMG00000032447
Gene type	protein-coding
Map location	20q11.23
Pascal p-value	0.826

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TGFBRAP1	0.95	0.95
AC097382.4	0.94	0.94
DHX37	0.94	0.95
SREBF2	0.94	0.95
NEURL4	0.93	0.95
CLIP2	0.93	0.94
DIP2C	0.93	0.94
FOXK2	0.93	0.95
KIAA1967	0.93	0.94
BICD2	0.93	0.93

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.79	-0.86
MT-CO2	-0.77	-0.86
AF347015.27	-0.76	-0.84
AF347015.21	-0.75	-0.91
AF347015.33	-0.74	-0.81
AC021016.1	-0.74	-0.82
FXYD1	-0.73	-0.80
AF347015.8	-0.73	-0.84
MT-CYB	-0.73	-0.81
HIGD1B	-0.73	-0.82

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	ISS	Neurotransmitter (GO term level: 4)	2477488
GO:0001530	lipopolysaccharide binding	IEA		-
GO:0008289	lipid binding	IEA		-
GO:0043498	cell surface binding	ISS		2477488
GO:0051636	Gram-negative bacterial cell surface binding	IDA		11528597
GO:0051636	Gram-negative bacterial cell surface binding	ISS		2402637
GO:0051637	Gram-positive bacterial cell surface binding	IDA		12932360
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0002281	macrophage activation during immune response	ISS		2402637
GO:0034145	positive regulation of toll-like receptor 4 signaling pathway	IDA		11528597
GO:0006968	cellular defense response	ISS		2402637
GO:0006953	acute-phase response	IEP		12932360
GO:0006953	acute-phase response	ISS		2477488
GO:0006869	lipid transport	IEA		-
GO:0008228	opsonization	IC		12932360
GO:0008228	opsonization	ISS		2477488
GO:0015920	lipopolysaccharide transport	IDA		8985160
GO:0032757	positive regulation of interleukin-8 production	IDA		8409400
GO:0032496	response to lipopolysaccharide	IDA		8409400 \|11739189
GO:0032490	detection of molecule of bacterial origin	IDA		11528597
GO:0032760	positive regulation of tumor necrosis factor production	IDA		8409400
GO:0032760	positive regulation of tumor necrosis factor production	ISS		2402637
GO:0032755	positive regulation of interleukin-6 production	IDA		8409400
GO:0032720	negative regulation of tumor necrosis factor production	IDA		11739189
GO:0031663	lipopolysaccharide-mediated signaling pathway	IDA		8409400 \|11739189
GO:0043032	positive regulation of macrophage activation	IDA		8409400
GO:0050830	defense response to Gram-positive bacterium	IC		12932360
GO:0050830	defense response to Gram-positive bacterium	IEP		12932360
GO:0050829	defense response to Gram-negative bacterium	ISS		2402637
GO:0045087	innate immune response	IC		12932360
GO:0045087	innate immune response	ISS		2477488
GO:0060265	positive regulation of respiratory burst during acute inflammatory response	ISS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	EXP		2477488 \|9665271
GO:0005576	extracellular region	IEA		-
GO:0005615	extracellular space	IDA		2402637 \|11528597
GO:0005615	extracellular space	ISS		2477488
GO:0005634	nucleus	IDA		18029348

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG TOLL LIKE RECEPTOR SIGNALING PATHWAY	102	88	All SZGR 2.0 genes in this pathway
BIOCARTA GSK3 PATHWAY	27	26	All SZGR 2.0 genes in this pathway
PID IL6 7 PATHWAY	47	40	All SZGR 2.0 genes in this pathway
REACTOME INNATE IMMUNE SYSTEM	279	178	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME TOLL RECEPTOR CASCADES	118	84	All SZGR 2.0 genes in this pathway
CASTELLANO NRAS TARGETS UP	68	41	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL	326	213	All SZGR 2.0 genes in this pathway
DAUER STAT3 TARGETS UP	49	35	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN	206	136	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN	357	212	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
NADLER OBESITY UP	61	34	All SZGR 2.0 genes in this pathway
ABBUD LIF SIGNALING 1 UP	46	29	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
URS ADIPOCYTE DIFFERENTIATION UP	74	51	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS UP	37	27	All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES DN	245	144	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
HAN JNK SINGALING DN	39	27	All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES UP	253	147	All SZGR 2.0 genes in this pathway
LEIN CHOROID PLEXUS MARKERS	103	61	All SZGR 2.0 genes in this pathway
COATES MACROPHAGE M1 VS M2 DN	78	44	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER ERBB2 UP	147	83	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA DN	100	63	All SZGR 2.0 genes in this pathway
ICHIBA GRAFT VERSUS HOST DISEASE D7 UP	107	67	All SZGR 2.0 genes in this pathway
ICHIBA GRAFT VERSUS HOST DISEASE 35D UP	131	79	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2	356	214	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 LCP WITH H3K4ME3	162	80	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT DN	222	141	All SZGR 2.0 genes in this pathway
KAMIKUBO MYELOID CEBPA NETWORK	28	19	All SZGR 2.0 genes in this pathway
STAMBOLSKY TARGETS OF MUTATED TP53 DN	50	24	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL PROGENITOR UP	58	30	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-500	162	168	m8	hsa-miR-500	AUGCACCUGGGCAAGGAUUCUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: LBP