Gene Page: LEPR
Summary ?
GeneID | 3953 |
Symbol | LEPR |
Synonyms | CD295|LEP-R|LEPRD|OB-R|OBR |
Description | leptin receptor |
Reference | MIM:601007|HGNC:HGNC:6554|Ensembl:ENSG00000116678|HPRD:03001|Vega:OTTHUMG00000009115 |
Gene type | protein-coding |
Map location | 1p31 |
Pascal p-value | 0.181 |
Fetal beta | -0.508 |
eGene | Cerebellum Frontal Cortex BA9 Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10958892 | chr9 | 10125117 | LEPR | 3953 | 0.12 | trans | ||
rs10958896 | chr9 | 10126894 | LEPR | 3953 | 0.1 | trans | ||
rs10958899 | chr9 | 10128700 | LEPR | 3953 | 0.15 | trans | ||
rs10958907 | chr9 | 10131580 | LEPR | 3953 | 0.19 | trans | ||
rs6095741 | chr20 | 48666589 | LEPR | 3953 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DVL2 | 0.95 | 0.90 |
FANCG | 0.94 | 0.90 |
CNTROB | 0.94 | 0.94 |
RCC1 | 0.93 | 0.89 |
UNK | 0.93 | 0.92 |
PLEKHG4B | 0.92 | 0.85 |
MCM7 | 0.92 | 0.76 |
C17orf53 | 0.92 | 0.89 |
BUD13 | 0.92 | 0.89 |
XRCC1 | 0.92 | 0.94 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.71 | -0.91 |
AF347015.27 | -0.71 | -0.90 |
MT-CO2 | -0.70 | -0.91 |
C5orf53 | -0.70 | -0.76 |
AF347015.33 | -0.69 | -0.90 |
HLA-F | -0.69 | -0.76 |
AIFM3 | -0.69 | -0.76 |
S100B | -0.69 | -0.84 |
MT-CYB | -0.68 | -0.89 |
ALDOC | -0.67 | -0.71 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004896 | cytokine receptor activity | IEA | - | |
GO:0005515 | protein binding | IPI | 11279102 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006112 | energy reserve metabolic process | TAS | 9537324 | |
GO:0007166 | cell surface receptor linked signal transduction | TAS | 9537324 | |
GO:0007275 | multicellular organismal development | TAS | 9537324 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
APOD | - | apolipoprotein D | - | HPRD | 11344130 |
CLU | AAG4 | APOJ | CLI | KUB1 | MGC24903 | SGP-2 | SGP2 | SP-40 | TRPM-2 | TRPM2 | clusterin | - | HPRD | 12824284 |
DGKZ | DAGK5 | DAGK6 | DGK-ZETA | hDGKzeta | diacylglycerol kinase, zeta 104kDa | - | HPRD | 11078732 |
JAK2 | JTK10 | Janus kinase 2 (a protein tyrosine kinase) | - | HPRD | 8608603 |
JAK3 | JAK-3 | JAK3_HUMAN | JAKL | L-JAK | LJAK | Janus kinase 3 (a protein tyrosine kinase, leukocyte) | Affinity Capture-Western | BioGRID | 11585385 |
LEP | FLJ94114 | OB | OBS | leptin | - | HPRD | 8608603 |
PIN1 | DOD | UBL5 | peptidylprolyl cis/trans isomerase, NIMA-interacting 1 | Two-hybrid | BioGRID | 16169070 |
PTPN11 | BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2 | protein tyrosine phosphatase, non-receptor type 11 | - | HPRD | 11018044 |
SNX1 | HsT17379 | MGC8664 | SNX1A | Vps5 | sorting nexin 1 | - | HPRD,BioGRID | 9819414 |
SNX2 | MGC5204 | TRG-9 | sorting nexin 2 | - | HPRD,BioGRID | 9819414 |
SNX4 | - | sorting nexin 4 | - | HPRD,BioGRID | 9819414 |
SNX6 | MGC3157 | MSTP010 | TFAF2 | sorting nexin 6 | - | HPRD,BioGRID | 11279102 |
SOCS3 | ATOD4 | CIS3 | Cish3 | MGC71791 | SOCS-3 | SSI-3 | SSI3 | suppressor of cytokine signaling 3 | - | HPRD,BioGRID | 11018044 |
STAT3 | APRF | FLJ20882 | HIES | MGC16063 | signal transducer and activator of transcription 3 (acute-phase response factor) | - | HPRD | 8608603 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION | 267 | 161 | All SZGR 2.0 genes in this pathway |
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
KEGG JAK STAT SIGNALING PATHWAY | 155 | 105 | All SZGR 2.0 genes in this pathway |
KEGG ADIPOCYTOKINE SIGNALING PATHWAY | 67 | 57 | All SZGR 2.0 genes in this pathway |
BIOCARTA LEPTIN PATHWAY | 11 | 11 | All SZGR 2.0 genes in this pathway |
PID PTP1B PATHWAY | 52 | 40 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT EARLY UP | 21 | 19 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID UP | 25 | 18 | All SZGR 2.0 genes in this pathway |
IGARASHI ATF4 TARGETS DN | 90 | 65 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
GRAHAM CML QUIESCENT VS NORMAL QUIESCENT UP | 87 | 45 | All SZGR 2.0 genes in this pathway |
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP | 181 | 101 | All SZGR 2.0 genes in this pathway |
GRAHAM NORMAL QUIESCENT VS NORMAL DIVIDING DN | 87 | 49 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID DN | 67 | 45 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
AMUNDSON RESPONSE TO ARSENITE | 217 | 143 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM6 | 46 | 32 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 UP | 140 | 85 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 3 UP | 17 | 11 | All SZGR 2.0 genes in this pathway |
CERVERA SDHB TARGETS 2 | 114 | 76 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER CIPROFIBRATE UP | 60 | 42 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER DENA UP | 60 | 40 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER E2F1 UP | 62 | 35 | All SZGR 2.0 genes in this pathway |
YAO HOXA10 TARGETS VIA PROGESTERONE UP | 79 | 58 | All SZGR 2.0 genes in this pathway |
SCHURINGA STAT5A TARGETS UP | 21 | 13 | All SZGR 2.0 genes in this pathway |
KANG IMMORTALIZED BY TERT UP | 89 | 61 | All SZGR 2.0 genes in this pathway |
YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
VARELA ZMPSTE24 TARGETS UP | 40 | 30 | All SZGR 2.0 genes in this pathway |
CLASPER LYMPHATIC VESSELS DURING METASTASIS UP | 20 | 12 | All SZGR 2.0 genes in this pathway |
LEIN CHOROID PLEXUS MARKERS | 103 | 61 | All SZGR 2.0 genes in this pathway |
HUANG FOXA2 TARGETS DN | 36 | 21 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL A UP | 84 | 52 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER POOR SURVIVAL UP | 31 | 22 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
MATZUK CENTRAL FOR FEMALE FERTILITY | 29 | 25 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
KRISHNAN FURIN TARGETS DN | 13 | 8 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE UP | 149 | 85 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS UNANNOTATED UP | 85 | 50 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA DN | 267 | 160 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 1 | 68 | 50 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS DN | 115 | 73 | All SZGR 2.0 genes in this pathway |
OHGUCHI LIVER HNF4A TARGETS UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS UP | 84 | 51 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
SERVITJA LIVER HNF1A TARGETS UP | 135 | 96 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-200bc/429 | 1802 | 1808 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.