Summary ?
GeneID399474
SymbolTMEM200B
SynonymsTTMB
Descriptiontransmembrane protein 200B
ReferenceHGNC:HGNC:33785|Ensembl:ENSG00000253304|HPRD:13188|Vega:OTTHUMG00000003658
Gene typeprotein-coding
Map location1p35
Pascal p-value8.363E-4
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs368407chr130439987TMEM200B3994740.12cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
LIU PROSTATE CANCER DN 481290All SZGR 2.0 genes in this pathway
LIAO METASTASIS 539324All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893528All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246153All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C 463262All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567365All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN 11573All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN 918550All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-3p9289351A,m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
miR-2610541060m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-2810921098m8hsa-miR-28brainAAGGAGCUCACAGUCUAUUGAG
miR-34/4495735791Ahsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-431906912m8hsa-miR-431UGUCUUGCAGGCCGUCAUGCA
miR-496104310491Ahsa-miR-496AUUACAUGGCCAAUCUC