SZGR2

Summary ?

GeneID	4000
Symbol	LMNA
Synonyms	CDCD1\|CDDC\|CMD1A\|CMT2B1\|EMD2\|FPL\|FPLD\|FPLD2\|HGPS\|IDC\|LDP1\|LFP\|LGMD1B\|LMN1\|LMNC\|LMNL1\|PRO1
Description	lamin A/C
Reference	MIM:150330\|HGNC:HGNC:6636\|Ensembl:ENSG00000160789\|HPRD:01035\|Vega:OTTHUMG00000013961
Gene type	protein-coding
Map location	1q22
Sherlock p-value	0.912
Fetal beta	-0.455
eGene	Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0235
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00814
Expression	Meta-analysis of gene expression	P value: 1.52
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0545

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs7022505	chr9	121213148	LMNA	4000	0.17	trans
rs289799	chr15	63720989	LMNA	4000	0.04	trans
rs4501739	chrX	35960848	LMNA	4000	0.02	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PTK2B	0.67	0.59
NRIP3	0.66	0.64
SUSD4	0.65	0.58
MYO18B	0.64	0.49
ESYT3	0.64	0.59
TUBA8	0.63	0.62
OGDHL	0.63	0.56
SGPP2	0.62	0.56
AUH	0.62	0.58
STEAP3	0.61	0.48

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RBMX2	-0.31	-0.31
ANP32C	-0.29	-0.34
GTF3C6	-0.28	-0.27
PLEKHO1	-0.28	-0.17
RPS20	-0.27	-0.35
CARHSP1	-0.27	-0.29
AC005393.1	-0.27	-0.19
RPL27A	-0.27	-0.35
RPL18	-0.26	-0.30
C9orf46	-0.26	-0.30

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		11801724
GO:0005198	structural molecule activity	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005882	intermediate filament	IEA		-
GO:0005634	nucleus	IDA		18029348
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IDA		18029348
GO:0005886	plasma membrane	IDA		18029348

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ALOX12	12-LOX \| 12S-LOX \| LOG12	arachidonate 12-lipoxygenase	12-LOX interacts with Lamin A.	BIND	10727209
ALOX12	12-LOX \| 12S-LOX \| LOG12	arachidonate 12-lipoxygenase	-	HPRD,BioGRID	10727209
ALOX12B	12R-LOX	arachidonate 12-lipoxygenase, 12R type	-	HPRD	10727209
EMD	EDMD \| LEMD5 \| STA	emerin	-	HPRD,BioGRID	10673356 \|11173535
KAT5	ESA1 \| HTATIP \| HTATIP1 \| PLIP \| TIP \| TIP60 \| cPLA2	K(lysine) acetyltransferase 5	Two-hybrid	BioGRID	16169070
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Lamin C interacts with Lamin A.	BIND	7628545
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Lamin C interacts with Lamin C.	BIND	7628545
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	-	HPRD	11792809
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Lamin A interacts with itself to form a homodimer.	BIND	7628545
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Prelamin A interacts with Lamin A.	BIND	7628545
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Prelamin A interacts with itself to form a homodimer.	BIND	7628545
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Prelamin A interacts with Lamin C.	BIND	7628545
LMNB1	ADLD \| LMN \| LMN2 \| LMNB \| MGC111419	lamin B1	Lamin A interacts with Lamin B1.	BIND	7628545
LMNB1	ADLD \| LMN \| LMN2 \| LMNB \| MGC111419	lamin B1	Prelamin A interacts with Lamin B1.	BIND	7628545
LMNB1	ADLD \| LMN \| LMN2 \| LMNB \| MGC111419	lamin B1	-	HPRD,BioGRID	11792809
LMNB1	ADLD \| LMN \| LMN2 \| LMNB \| MGC111419	lamin B1	Lamin C interacts with Lamin B1.	BIND	7628545
NARF	DKFZp434G0420 \| FLJ10067 \| IOP2	nuclear prelamin A recognition factor	-	HPRD,BioGRID	10514485
PRKCA	AAG6 \| MGC129900 \| MGC129901 \| PKC-alpha \| PKCA \| PRKACA	protein kinase C, alpha	-	HPRD,BioGRID	12112001
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD,BioGRID	8058329 \|8278403
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	Rb interacts with lamin C	BIND	12475961
SREBF1	SREBP-1c \| SREBP1 \| bHLHd1	sterol regulatory element binding transcription factor 1	-	HPRD,BioGRID	11929849
SYNE1	8B \| CPG2 \| DKFZp781J13156 \| FLJ30878 \| FLJ41140 \| KIAA0796 \| KIAA1262 \| KIAA1756 \| MYNE1 \| SCAR8	spectrin repeat containing, nuclear envelope 1	-	HPRD,BioGRID	11801724
TMPO	CMD1T \| LAP2 \| LEMD4 \| MGC61508 \| PRO0868 \| TP	thymopoietin	-	HPRD,BioGRID	10984438 \|12475961
TOR1AIP1	DKFZp586G011 \| FLJ13142 \| LAP1B \| MGC3413	torsin A interacting protein 1	-	HPRD,BioGRID	8324822
URB2	KIAA0133 \| MGC138837 \| MGC138838 \| NPA2	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	Lamin A interacts with Lco1.	BIND	15265697
URB2	KIAA0133 \| MGC138837 \| MGC138838 \| NPA2	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	-	HPRD	15265697
URB2	KIAA0133 \| MGC138837 \| MGC138838 \| NPA2	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	Lamin C interacts with Lco1.	BIND	15265697
ZNF239	HOK-2 \| MOK2	zinc finger protein 239	-	HPRD,BioGRID	12409453

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM	85	65	All SZGR 2.0 genes in this pathway
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC	76	59	All SZGR 2.0 genes in this pathway
KEGG DILATED CARDIOMYOPATHY	92	68	All SZGR 2.0 genes in this pathway
BIOCARTA CASPASE PATHWAY	23	15	All SZGR 2.0 genes in this pathway
BIOCARTA FAS PATHWAY	30	22	All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA DEATH PATHWAY	33	24	All SZGR 2.0 genes in this pathway
BIOCARTA TNFR1 PATHWAY	29	21	All SZGR 2.0 genes in this pathway
PID CASPASE PATHWAY	52	39	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC CLEAVAGE OF CELLULAR PROTEINS	40	26	All SZGR 2.0 genes in this pathway
REACTOME MEIOSIS	116	81	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME DIABETES PATHWAYS	133	91	All SZGR 2.0 genes in this pathway
REACTOME ACTIVATION OF CHAPERONE GENES BY XBP1S	46	34	All SZGR 2.0 genes in this pathway
REACTOME UNFOLDED PROTEIN RESPONSE	80	51	All SZGR 2.0 genes in this pathway
REACTOME CHROMOSOME MAINTENANCE	122	80	All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS	148	94	All SZGR 2.0 genes in this pathway
REACTOME MEIOTIC SYNAPSIS	73	57	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC EXECUTION PHASE	54	37	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN	335	193	All SZGR 2.0 genes in this pathway
DITTMER PTHLH TARGETS DN	73	51	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
GRAHAM CML QUIESCENT VS NORMAL QUIESCENT UP	87	45	All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP	181	101	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
KERLEY RESPONSE TO CISPLATIN UP	44	30	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM1	229	137	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX	230	156	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
LIN APC TARGETS	77	55	All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC	182	116	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION UP	140	83	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP	183	111	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
CROMER METASTASIS DN	81	58	All SZGR 2.0 genes in this pathway
IGLESIAS E2F TARGETS UP	151	103	All SZGR 2.0 genes in this pathway
MOREAUX B LYMPHOCYTE MATURATION BY TACI UP	92	58	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR DN	86	62	All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS UP	56	35	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
MAHAJAN RESPONSE TO IL1A DN	76	57	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
ZHU CMV 8 HR DN	53	40	All SZGR 2.0 genes in this pathway
CHEN PDGF TARGETS	19	9	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP	100	72	All SZGR 2.0 genes in this pathway
ZHU CMV ALL DN	128	93	All SZGR 2.0 genes in this pathway
ZHONG SECRETOME OF LUNG CANCER AND FIBROBLAST	132	93	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G	171	96	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP	863	514	All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE UP	126	92	All SZGR 2.0 genes in this pathway
MATZUK SPERMATOCYTE	72	55	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
GOLDRATH ANTIGEN RESPONSE	346	192	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 UP	113	70	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17	181	101	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 M	216	124	All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER UP	307	182	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS GROWING	243	155	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS UP	295	155	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS DN	242	146	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A	182	108	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR UP	166	97	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	284	291	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	284	290	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	284	290	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-129-5p	196	203	1A,m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	196	203	1A,m8	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-205	180	186	1A	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-450	196	202	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-9	293	300	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-9	293	300	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: LMNA