SZGR2

Summary ?

GeneID	4001
Symbol	LMNB1
Synonyms	ADLD\|LMN\|LMN2\|LMNB
Description	lamin B1
Reference	MIM:150340\|HGNC:HGNC:6637\|Ensembl:ENSG00000113368\|HPRD:01036\|Vega:OTTHUMG00000128969
Gene type	protein-coding
Map location	5q23.2
Pascal p-value	0.165
Fetal beta	3.841
DMG	2 (# studies)
eGene	Meta
Support	G2Cdb.humanNRC

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
GSMA_I	Genome scan meta-analysis	Psr: 0.0032
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0147

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg10204478	5	126163548	LMNB1	1.057E-4	0.274	0.028	DMG:Wockner_2014
cg23953133	5	126112875	LMNB1		-0.02	0.43	DMG:Nishioka_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
UTRN	0.75	0.76
AFF1	0.73	0.74
ASXL2	0.73	0.71
ATXN1L	0.70	0.70
WNK1	0.70	0.70
PTPN11	0.69	0.68
CREB3L2	0.69	0.68
NTRK2	0.69	0.69
KIAA1671	0.68	0.72
DDR2	0.68	0.71

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PFDN5	-0.40	-0.46
C8orf59	-0.39	-0.46
ST20	-0.39	-0.49
RPL31	-0.39	-0.48
RPL35	-0.38	-0.45
CCDC72	-0.37	-0.43
ATP5E	-0.37	-0.48
MRPL52	-0.37	-0.44
ROMO1	-0.37	-0.44
PHPT1	-0.37	-0.40

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005198	structural molecule activity	IEA		-
GO:0005198	structural molecule activity	TAS		7557986
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005637	nuclear inner membrane	IEA		-
GO:0005638	lamin filament	IEA		-
GO:0005638	lamin filament	TAS		7557986
GO:0016020	membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	-	HPRD	11901153
CASP6	MCH2	caspase 6, apoptosis-related cysteine peptidase	-	HPRD	11901153
CDC2	CDC28A \| CDK1 \| DKFZp686L20222 \| MGC111195	cell division cycle 2, G1 to S and G2 to M	-	HPRD	11901153
EMD	EDMD \| LEMD5 \| STA	emerin	Affinity Capture-Western	BioGRID	12670476
LBR	DHCR14B \| FLJ43126 \| LMN2R \| MGC9041 \| PHA	lamin B receptor	-	HPRD,BioGRID	12490158
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Lamin A interacts with Lamin B1.	BIND	7628545
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Prelamin A interacts with Lamin B1.	BIND	7628545
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	-	HPRD,BioGRID	11792809
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Lamin C interacts with Lamin B1.	BIND	7628545
LMNB1	ADLD \| LMN \| LMN2 \| LMNB \| MGC111419	lamin B1	Lamin B1 interacts with itself to form a homodimer.	BIND	7628545
PRKCA	AAG6 \| MGC129900 \| MGC129901 \| PKC-alpha \| PKCA \| PRKACA	protein kinase C, alpha	-	HPRD,BioGRID	11901153 \|12135703
PRKCB	MGC41878 \| PKC-beta \| PKCB \| PRKCB1 \| PRKCB2	protein kinase C, beta	-	HPRD,BioGRID	11901153
PRKCD	MAY1 \| MGC49908 \| PKCD \| nPKC-delta	protein kinase C, delta	-	HPRD	11901153
PRPH	NEF4 \| PRPH1	peripherin	-	HPRD	1986862
TMPO	CMD1T \| LAP2 \| LEMD4 \| MGC61508 \| PRO0868 \| TP	thymopoietin	-	HPRD,BioGRID	9490046
TOR1AIP1	DKFZp586G011 \| FLJ13142 \| LAP1B \| MGC3413	torsin A interacting protein 1	-	HPRD	9305626
URB2	KIAA0133 \| MGC138837 \| MGC138838 \| NPA2	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	Lamin B1 interacts with Lco1.	BIND	15265697
URB2	KIAA0133 \| MGC138837 \| MGC138838 \| NPA2	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	-	HPRD	15265697

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA CASPASE PATHWAY	23	15	All SZGR 2.0 genes in this pathway
BIOCARTA FAS PATHWAY	30	22	All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA TNFR1 PATHWAY	29	21	All SZGR 2.0 genes in this pathway
PID CASPASE PATHWAY	52	39	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC CLEAVAGE OF CELLULAR PROTEINS	40	26	All SZGR 2.0 genes in this pathway
REACTOME MEIOSIS	116	81	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME CHROMOSOME MAINTENANCE	122	80	All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS	148	94	All SZGR 2.0 genes in this pathway
REACTOME MEIOTIC SYNAPSIS	73	57	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC EXECUTION PHASE	54	37	All SZGR 2.0 genes in this pathway
SOTIRIOU BREAST CANCER GRADE 1 VS 3 UP	151	84	All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 UP	146	86	All SZGR 2.0 genes in this pathway
IGARASHI ATF4 TARGETS DN	90	65	All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS DN	310	188	All SZGR 2.0 genes in this pathway
GAL LEUKEMIC STEM CELL DN	244	153	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP	214	134	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP	633	376	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP	552	347	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION DN	122	67	All SZGR 2.0 genes in this pathway
TANG SENESCENCE TP53 TARGETS DN	57	33	All SZGR 2.0 genes in this pathway
KAN RESPONSE TO ARSENIC TRIOXIDE	123	80	All SZGR 2.0 genes in this pathway
KONG E2F3 TARGETS	97	58	All SZGR 2.0 genes in this pathway
ROSTY CERVICAL CANCER PROLIFERATION CLUSTER	140	73	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER UP	227	137	All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK	168	103	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
PUJANA BRCA CENTERED NETWORK	117	72	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN	637	377	All SZGR 2.0 genes in this pathway
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE UP	167	92	All SZGR 2.0 genes in this pathway
GARCIA TARGETS OF FLI1 AND DAX1 DN	176	104	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
MORI PRE BI LYMPHOCYTE UP	80	54	All SZGR 2.0 genes in this pathway
MORI LARGE PRE BII LYMPHOCYTE UP	86	49	All SZGR 2.0 genes in this pathway
MORI IMMATURE B LYMPHOCYTE DN	90	55	All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE DN	75	43	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS UP	108	75	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN	337	230	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS DN	65	36	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 DN	163	115	All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION DN	87	57	All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP	131	87	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
KANG DOXORUBICIN RESISTANCE UP	54	33	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM UP	84	58	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
RAMASWAMY METASTASIS UP	66	43	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
GENTILE UV LOW DOSE DN	67	46	All SZGR 2.0 genes in this pathway
KRASNOSELSKAYA ILF3 TARGETS DN	46	38	All SZGR 2.0 genes in this pathway
GENTILE RESPONSE CLUSTER D3	61	39	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN UP	181	112	All SZGR 2.0 genes in this pathway
FUJII YBX1 TARGETS DN	202	132	All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE E2	28	21	All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C	463	262	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS DN	145	93	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP	250	168	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
FLOTHO PEDIATRIC ALL THERAPY RESPONSE DN	29	17	All SZGR 2.0 genes in this pathway
GOLDRATH ANTIGEN RESPONSE	346	192	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP	338	225	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF DN	235	144	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN	245	150	All SZGR 2.0 genes in this pathway
CHANG CYCLING GENES	148	83	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6	456	285	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
ZHAN EARLY DIFFERENTIATION GENES DN	42	29	All SZGR 2.0 genes in this pathway
CROONQUIST IL6 DEPRIVATION DN	98	69	All SZGR 2.0 genes in this pathway
CROONQUIST NRAS SIGNALING DN	72	47	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE UP	181	106	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP	178	108	All SZGR 2.0 genes in this pathway
KOBAYASHI EGFR SIGNALING 24HR DN	251	151	All SZGR 2.0 genes in this pathway
PYEON CANCER HEAD AND NECK VS CERVICAL UP	193	95	All SZGR 2.0 genes in this pathway
WONG EMBRYONIC STEM CELL CORE	335	193	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2	182	102	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT	572	352	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS LOW SERUM	100	51	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP	324	193	All SZGR 2.0 genes in this pathway
THILLAINADESAN ZNF217 TARGETS UP	44	22	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP	570	339	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7	403	240	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS UP	221	120	All SZGR 2.0 genes in this pathway
ABRAMSON INTERACT WITH AIRE	45	33	All SZGR 2.0 genes in this pathway
ZHOU CELL CYCLE GENES IN IR RESPONSE 6HR	85	49	All SZGR 2.0 genes in this pathway
ZHOU CELL CYCLE GENES IN IR RESPONSE 24HR	128	73	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	231	237	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-124.1	131	137	1A	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-218	74	80	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-23	198	204	1A	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
				hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-30-3p	151	157	m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	151	157	m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: LMNB1