Gene Page: ARNTL
Summary ?
| GeneID | 406 |
| Symbol | ARNTL |
| Synonyms | BMAL1|BMAL1c|JAP3|MOP3|PASD3|TIC|bHLHe5 |
| Description | aryl hydrocarbon receptor nuclear translocator like |
| Reference | MIM:602550|HGNC:HGNC:701|Ensembl:ENSG00000133794|HPRD:03973|Vega:OTTHUMG00000150623 |
| Gene type | protein-coding |
| Map location | 11p15 |
| Pascal p-value | 0.016 |
| Sherlock p-value | 0.475 |
| Fetal beta | -1.755 |
| eGene | Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| STK25 | 0.88 | 0.83 |
| PSMB2 | 0.85 | 0.82 |
| DDX41 | 0.85 | 0.80 |
| TCF25 | 0.85 | 0.78 |
| RXRB | 0.85 | 0.82 |
| MARS | 0.84 | 0.80 |
| AGAP3 | 0.84 | 0.77 |
| GDI1 | 0.84 | 0.81 |
| CACNB3 | 0.84 | 0.79 |
| FARSA | 0.83 | 0.75 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MT-CO2 | -0.76 | -0.67 |
| AF347015.26 | -0.75 | -0.69 |
| MT-CYB | -0.72 | -0.66 |
| AF347015.31 | -0.72 | -0.67 |
| AF347015.33 | -0.72 | -0.65 |
| AF347015.2 | -0.72 | -0.64 |
| AF347015.8 | -0.72 | -0.66 |
| NOSTRIN | -0.70 | -0.67 |
| AF347015.21 | -0.69 | -0.67 |
| AF347015.18 | -0.69 | -0.68 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004871 | signal transducer activity | IEA | - | |
| GO:0003700 | transcription factor activity | IEA | - | |
| GO:0017162 | aryl hydrocarbon receptor binding | IPI | 9079689 | |
| GO:0051879 | Hsp90 protein binding | IDA | 9079689 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0007623 | circadian rhythm | TAS | 9616112 | |
| GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IGI | 9576906 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005667 | transcription factor complex | IPI | 9576906 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| AHR | - | aryl hydrocarbon receptor | - | HPRD,BioGRID | 9079689 |
| BHLHB2 | DEC1 | SHARP-2 | STRA13 | Stra14 | bHLHe40 | basic helix-loop-helix domain containing, class B, 2 | - | HPRD | 12397359 |
| CLOCK | KAT13D | KIAA0334 | bHLHe8 | clock homolog (mouse) | Two-hybrid | BioGRID | 11439184 |14701734 |
| CLOCK | KAT13D | KIAA0334 | bHLHe8 | clock homolog (mouse) | - | HPRD | 9989497 |
| CRY1 | PHLL1 | cryptochrome 1 (photolyase-like) | - | HPRD,BioGRID | 10531061 |
| CSNK1E | HCKIE | MGC10398 | casein kinase 1, epsilon | - | HPRD,BioGRID | 11875063 |
| EP300 | KAT3B | p300 | E1A binding protein p300 | Reconstituted Complex | BioGRID | 14645221 |
| EPAS1 | ECYT4 | HIF2A | HLF | MOP2 | PASD2 | endothelial PAS domain protein 1 | - | HPRD,BioGRID | 9576906 |
| HIF1A | HIF-1alpha | HIF1 | HIF1-ALPHA | MOP1 | PASD8 | hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) | - | HPRD,BioGRID | 9576906 |
| HSP90AA1 | FLJ31884 | HSP86 | HSP89A | HSP90A | HSP90N | HSPC1 | HSPCA | HSPCAL1 | HSPCAL4 | HSPN | Hsp89 | Hsp90 | LAP2 | heat shock protein 90kDa alpha (cytosolic), class A member 1 | - | HPRD,BioGRID | 9079689 |
| KAT2B | CAF | P | P/CAF | PCAF | K(lysine) acetyltransferase 2B | Reconstituted Complex | BioGRID | 14645221 |
| NPAS2 | FLJ23138 | MGC71151 | MOP4 | PASD4 | bHLHe9 | neuronal PAS domain protein 2 | in vitro in vivo Two-hybrid | BioGRID | 9576906 |11439184 |
| NPAS4 | Le-PAS | NXF | PASD10 | neuronal PAS domain protein 4 | - | HPRD,BioGRID | 14701734 |
| RARA | NR1B1 | RAR | retinoic acid receptor, alpha | Reconstituted Complex | BioGRID | 11439184 |
| RXRA | FLJ00280 | FLJ00318 | FLJ16020 | FLJ16733 | MGC102720 | NR2B1 | retinoid X receptor, alpha | Reconstituted Complex | BioGRID | 11439184 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CIRCADIAN RHYTHM MAMMAL | 13 | 13 | All SZGR 2.0 genes in this pathway |
| PID CIRCADIAN PATHWAY | 16 | 15 | All SZGR 2.0 genes in this pathway |
| REACTOME BMAL1 CLOCK NPAS2 ACTIVATES CIRCADIAN EXPRESSION | 36 | 27 | All SZGR 2.0 genes in this pathway |
| REACTOME PPARA ACTIVATES GENE EXPRESSION | 104 | 72 | All SZGR 2.0 genes in this pathway |
| REACTOME RORA ACTIVATES CIRCADIAN EXPRESSION | 24 | 17 | All SZGR 2.0 genes in this pathway |
| REACTOME CIRCADIAN REPRESSION OF EXPRESSION BY REV ERBA | 23 | 16 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
| REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
| REACTOME CIRCADIAN CLOCK | 53 | 40 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| RIZ ERYTHROID DIFFERENTIATION | 77 | 51 | All SZGR 2.0 genes in this pathway |
| RASHI RESPONSE TO IONIZING RADIATION 6 | 84 | 54 | All SZGR 2.0 genes in this pathway |
| AMUNDSON RESPONSE TO ARSENITE | 217 | 143 | All SZGR 2.0 genes in this pathway |
| WIEMANN TELOMERE SHORTENING AND CHRONIC LIVER DAMAGE UP | 8 | 5 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| SHIPP DLBCL CURED VS FATAL DN | 45 | 30 | All SZGR 2.0 genes in this pathway |
| UEDA CENTRAL CLOCK | 88 | 62 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL CIS | 128 | 77 | All SZGR 2.0 genes in this pathway |
| UEDA PERIFERAL CLOCK | 169 | 111 | All SZGR 2.0 genes in this pathway |
| DORSAM HOXA9 TARGETS DN | 32 | 22 | All SZGR 2.0 genes in this pathway |
| KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 6HR UP | 71 | 48 | All SZGR 2.0 genes in this pathway |
| BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
| TUOMISTO TUMOR SUPPRESSION BY COL13A1 UP | 18 | 9 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
| MATZUK STEROIDOGENESIS | 7 | 6 | All SZGR 2.0 genes in this pathway |
| CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
| CUI GLUCOSE DEPRIVATION | 60 | 44 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
| KATSANOU ELAVL1 TARGETS DN | 148 | 88 | All SZGR 2.0 genes in this pathway |
| SERVITJA LIVER HNF1A TARGETS DN | 157 | 105 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-141/200a | 193 | 199 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-142-3p | 352 | 359 | 1A,m8 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
| miR-153 | 317 | 323 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-155 | 238 | 244 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-203.1 | 329 | 335 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-27 | 65 | 71 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-381 | 245 | 251 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-448 | 316 | 323 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-494 | 490 | 496 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-505 | 267 | 274 | 1A,m8 | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.