SZGR2

Summary ?

GeneID	4209
Symbol	MEF2D
Synonyms	-
Description	myocyte enhancer factor 2D
Reference	MIM:600663\|HGNC:HGNC:6997\|Ensembl:ENSG00000116604\|HPRD:02810\|Vega:OTTHUMG00000033095
Gene type	protein-coding
Map location	1q12-q23
Fetal beta	-1.693
DMG	2 (# studies)
eGene	Myers' cis & trans
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0235
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00814
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg15070096	1	156470876	MEF2D	2.403E-4	-0.319	0.037	DMG:Wockner_2014
cg12484590	1	156475177	MEF2D	3.89E-10	-0.029	7.56E-7	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1507047	chr16	50932778	MEF2D	4209		0.19		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RPUSD3	0.84	0.84
MECR	0.82	0.85
TRUB2	0.82	0.78
SLC25A11	0.82	0.76
OAZ1	0.81	0.82
MRPS7	0.81	0.79
POP4	0.81	0.81
MRPL17	0.81	0.81
ERI3	0.80	0.77
STOML2	0.80	0.79

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.18	-0.44	-0.28
AC010300.1	-0.42	-0.45
EIF5B	-0.39	-0.44
AC100783.1	-0.37	-0.28
C10orf108	-0.36	-0.32
HSP90AB4P	-0.36	-0.36
AC016705.1	-0.35	-0.24
AF347015.26	-0.35	-0.20
ANP32C	-0.35	-0.36
AC005921.3	-0.34	-0.48

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0003700	transcription factor activity	NAS		8575763
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0007517	muscle development	TAS		8269842
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CABIN1	CAIN \| KIAA0330 \| PPP3IN	calcineurin binding protein 1	Affinity Capture-Western Reconstituted Complex	BioGRID	10531067 \|10933397
CABIN1	CAIN \| KIAA0330 \| PPP3IN	calcineurin binding protein 1	MEF2D interacts with CABIN1.	BIND	15902271
EP300	KAT3B \| p300	E1A binding protein p300	Affinity Capture-Western	BioGRID	10825153 \|10933397
HDAC4	HA6116 \| HD4 \| HDAC-A \| HDACA \| KIAA0288	histone deacetylase 4	-	HPRD,BioGRID	10523670
HDAC5	FLJ90614 \| HD5 \| NY-CO-9	histone deacetylase 5	Affinity Capture-Western	BioGRID	12896970
MAPK7	BMK1 \| ERK4 \| ERK5 \| PRKM7	mitogen-activated protein kinase 7	-	HPRD,BioGRID	9753748
MEF2A	ADCAD1 \| RSRFC4 \| RSRFC9	myocyte enhancer factor 2A	-	HPRD,BioGRID	8798771 \|9858528
MEF2C	-	myocyte enhancer factor 2C	-	HPRD	9858528
MEF2D	DKFZp686I1536	myocyte enhancer factor 2D	-	HPRD	9858528
NFATC2	KIAA0611 \| NFAT1 \| NFATP	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	-	HPRD,BioGRID	10944115
SP1	-	Sp1 transcription factor	-	HPRD,BioGRID	12213324
YWHAQ	14-3-3 \| 1C5 \| HS1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	11433030

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA AT1R PATHWAY	36	28	All SZGR 2.0 genes in this pathway
BIOCARTA HDAC PATHWAY	32	25	All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY	87	68	All SZGR 2.0 genes in this pathway
BIOCARTA P38MAPK PATHWAY	40	31	All SZGR 2.0 genes in this pathway
BIOCARTA PGC1A PATHWAY	26	20	All SZGR 2.0 genes in this pathway
BIOCARTA ERK5 PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA MEF2D PATHWAY	23	16	All SZGR 2.0 genes in this pathway
PID HDAC CLASSIII PATHWAY	25	20	All SZGR 2.0 genes in this pathway
PID NFAT 3PATHWAY	54	47	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME MYOGENESIS	28	20	All SZGR 2.0 genes in this pathway
REACTOME CIRCADIAN CLOCK	53	40	All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP	276	187	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN	335	193	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP	175	108	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP	207	128	All SZGR 2.0 genes in this pathway
EBAUER MYOGENIC TARGETS OF PAX3 FOXO1 FUSION	50	26	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
KIM GASTRIC CANCER CHEMOSENSITIVITY	103	64	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 12HR UP	111	68	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER DN	101	65	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE DN	209	137	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE DN	204	114	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 DN	88	61	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 DN	82	51	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1224	1230	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-101	1275	1281	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-103/107	308	315	1A,m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	308	315	1A,m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-122	3688	3694	m8	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-125/351	3164	3170	1A	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	3164	3170	1A	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-144	1275	1281	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-18	3309	3315	m8	hsa-miR-18a	UAAGGUGCAUCUAGUGCAGAUA
miR-18	3309	3315	m8	hsa-miR-18b	UAAGGUGCAUCUAGUGCAGUUA
miR-182	3102	3109	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-19	290	296	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	290	296	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-216	1368	1374	m8	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-219	3677	3684	1A,m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-219	3677	3684	1A,m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-25/32/92/363/367	858	865	1A,m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-28	1168	1174	m8	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG
miR-30-3p	452	458	m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	452	458	m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-369-3p	167	173	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	167	173	m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-378*	3726	3732	1A	hsa-miR-422b	CUGGACUUGGAGUCAGAAGGCC
miR-378*	3726	3732	1A	hsa-miR-422a	CUGGACUUAGGGUCAGAAGGCC
miR-485-5p	22	28	m8	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC
miR-96	3103	3109	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MEF2D