Summary ?
GeneID440279
SymbolUNC13C
Synonyms-
Descriptionunc-13 homolog C (C. elegans)
ReferenceMIM:614568|HGNC:HGNC:23149|
Gene typeprotein-coding
Map location15q21.3
Pascal p-value0.012
Sherlock p-value0.881
TADA p-value0.024
Fetal beta-2.569
eGeneCerebellum
SupportCANABINOID
EXOCYTOSIS
METABOTROPIC GLUTAMATE RECEPTOR
SEROTONIN
CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DNM:Xu_2012Whole Exome Sequencing analysisDe novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@DNM table

GeneChromosomePositionRefAltTranscriptAA changeMutation typeSiftCG46TraitStudy
UNC13Cchr1554586124GTNM_001080534p.1284V>FmissenseSchizophreniaDNM:Xu_2012


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008270zinc ion bindingIEA-
GO:0019992diacylglycerol bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007268synaptic transmissionIEAneuron, Synap, Neurotransmitter (GO term level: 6)-
GO:0007242intracellular signaling cascadeIEA-
GO:0006887exocytosisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
XU GH1 EXOGENOUS TARGETS UP 8550All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP 268157All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN 258160All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1285685751A,m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-137604610m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-1821931991Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-1867497561A,m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-275695761A,m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-33014051411m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-34/4496656711Ahsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-495140814141Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-4962062121Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-5436975m8hsa-miR-543AAACAUUCGCGGUGCACUUCU
miR-961921991A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC