SZGR2

Summary ?

GeneID	4478
Symbol	MSN
Synonyms	HEL70
Description	moesin
Reference	MIM:309845\|HGNC:HGNC:7373\|Ensembl:ENSG00000147065\|HPRD:02399\|Vega:OTTHUMG00000021723
Gene type	protein-coding
Map location	Xq11.1
Sherlock p-value	0.86
Support	CompositeSet Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizotypy,schizophrenias,schizotypal	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.004

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ENHO	0.92	0.89
SCRG1	0.91	0.93
MT1E	0.90	0.97
MT1G	0.89	0.89
S100A13	0.88	0.92
C2orf82	0.88	0.88
AC044839.2	0.87	0.91
PSMB8	0.87	0.90
TMEM219	0.86	0.79
CBR3	0.86	0.86

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MCM3AP	-0.72	-0.84
PDXDC1	-0.72	-0.84
USP7	-0.71	-0.80
CKAP5	-0.71	-0.85
HEATR5B	-0.71	-0.85
GIGYF2	-0.71	-0.81
RBM26	-0.71	-0.85
ABCF1	-0.71	-0.76
RNASEN	-0.71	-0.88
ANKRD17	-0.71	-0.81

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	IPI	Neurotransmitter (GO term level: 4)	15819698
GO:0005200	structural constituent of cytoskeleton	TAS		1924289
GO:0008092	cytoskeletal protein binding	IEA		-
GO:0050839	cell adhesion molecule binding	IPI		12082081
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0022614	membrane to membrane docking	IEP		12082081
GO:0006928	cell motion	TAS		16130169
GO:0007159	leukocyte adhesion	IEP		12082081
GO:0050900	leukocyte migration	IEP		12082081
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030175	filopodium	IDA	axon (GO term level: 5)	12082081
GO:0001931	uropod	IEA	Synap (GO term level: 5)	-
GO:0005856	cytoskeleton	TAS		16130169
GO:0005737	cytoplasm	IEA		-
GO:0005902	microvillus	IDA		12082081
GO:0005886	plasma membrane	TAS		1924289 \|8188263
GO:0016323	basolateral plasma membrane	IEA		-
GO:0016324	apical plasma membrane	IEA		-
GO:0019898	extrinsic to membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ARHGDIA	GDIA1 \| MGC117248 \| RHOGDI \| RHOGDI-1	Rho GDP dissociation inhibitor (GDI) alpha	Co-purification	BioGRID	15659383
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	Co-purification	BioGRID	15659383
CASP10	ALPS2 \| FLICE2 \| MCH4	caspase 10, apoptosis-related cysteine peptidase	Co-purification	BioGRID	15659383
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	Co-purification	BioGRID	15659383
CD46	MCP \| MGC26544 \| MIC10 \| TLX \| TRA2.10	CD46 molecule, complement regulatory protein	-	HPRD	7884872\|12082081
CD46	MCP \| MGC26544 \| MIC10 \| TLX \| TRA2.10	CD46 molecule, complement regulatory protein	-	HPRD,BioGRID	7884872
CD93	C1QR1 \| C1qR(P) \| C1qRP \| CDw93 \| MXRA4 \| dJ737E23.1	CD93 molecule	Moesin interacts with CD93.	BIND	15819698
EZR	CVIL \| CVL \| DKFZp762H157 \| FLJ26216 \| MGC1584 \| VIL2	ezrin	-	HPRD,BioGRID	7579708 \|8248180
FADD	GIG3 \| MGC8528 \| MORT1	Fas (TNFRSF6)-associated via death domain	Co-purification	BioGRID	15659383
FAS	ALPS1A \| APO-1 \| APT1 \| CD95 \| FAS1 \| FASTM \| TNFRSF6	Fas (TNF receptor superfamily, member 6)	Co-purification	BioGRID	15659383
FASLG	APT1LG1 \| CD178 \| CD95L \| FASL \| TNFSF6	Fas ligand (TNF superfamily, member 6)	Co-purification	BioGRID	15659383
HLA-B	AS \| HLA-B-7301 \| HLA-B73 \| HLAB \| HLAC \| SPDA1	major histocompatibility complex, class I, B	Affinity Capture-MS	BioGRID	17353931
ICAM1	BB2 \| CD54 \| P3.58	intercellular adhesion molecule 1	-	HPRD	12082081
ICAM2	CD102	intercellular adhesion molecule 2	-	HPRD,BioGRID	9472040
ICAM3	CD50 \| CDW50 \| ICAM-R	intercellular adhesion molecule 3	-	HPRD,BioGRID	11784723
L1CAM	CAML1 \| CD171 \| HSAS \| HSAS1 \| MASA \| MIC5 \| N-CAML1 \| S10 \| SPG1	L1 cell adhesion molecule	-	HPRD	12070130
MAPK8	JNK \| JNK1 \| JNK1A2 \| JNK21B1/2 \| PRKM8 \| SAPK1	mitogen-activated protein kinase 8	Co-purification	BioGRID	15659383
MSN	-	moesin	-	HPRD,BioGRID	10847681
NCF1	FLJ79451 \| NCF1A \| NOXO2 \| SH3PXD1A \| p47phox	neutrophil cytosolic factor 1	Affinity Capture-Western Reconstituted Complex	BioGRID	11716484
NCF4	MGC3810 \| NCF \| P40PHOX \| SH3PXD4	neutrophil cytosolic factor 4, 40kDa	-	HPRD,BioGRID	11716484
PLEC1	EBS1 \| EBSO \| HD1 \| PCN \| PLEC1b \| PLTN	plectin 1, intermediate filament binding protein 500kDa	-	HPRD,BioGRID	11441066
RHOA	ARH12 \| ARHA \| RHO12 \| RHOH12	ras homolog gene family, member A	Co-purification	BioGRID	15659383
SELL	CD62L \| LAM-1 \| LAM1 \| LECAM1 \| LNHR \| LSEL \| LYAM1 \| Leu-8 \| Lyam-1 \| PLNHR \| TQ1 \| hLHRc	selectin L	Reconstituted Complex	BioGRID	11706008
SELPLG	CD162 \| CLA \| PSGL-1 \| PSGL1	selectin P ligand	-	HPRD,BioGRID	12115638
SLC9A3R1	EBP50 \| NHERF \| NHERF1 \| NPHLOP2	solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1	moesin interacts with hNHE-RF.	BIND	9430655
SLC9A3R1	EBP50 \| NHERF \| NHERF1 \| NPHLOP2	solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1	-	HPRD,BioGRID	9430655
SPN	CD43 \| GPL115 \| LSN	sialophorin	-	HPRD,BioGRID	9616160
SYK	DKFZp313N1010 \| FLJ25043 \| FLJ37489	spleen tyrosine kinase	Syk interacts with moesin. This interaction was modeled on a demonstrated interaction between Syk and moesin from unspecified species.	BIND	12387735
TNFRSF10B	CD262 \| DR5 \| KILLER \| KILLER/DR5 \| TRAIL-R2 \| TRAILR2 \| TRICK2 \| TRICK2A \| TRICK2B \| TRICKB \| ZTNFR9	tumor necrosis factor receptor superfamily, member 10b	Co-purification	BioGRID	15659383
TNFRSF1A	CD120a \| FPF \| MGC19588 \| TBP1 \| TNF-R \| TNF-R-I \| TNF-R55 \| TNFAR \| TNFR1 \| TNFR55 \| TNFR60 \| p55 \| p55-R \| p60	tumor necrosis factor receptor superfamily, member 1A	Co-purification	BioGRID	15659383
TSC1	KIAA0243 \| LAM \| MGC86987 \| TSC	tuberous sclerosis 1	-	HPRD,BioGRID	12226091
TSC1	KIAA0243 \| LAM \| MGC86987 \| TSC	tuberous sclerosis 1	Hamartin interacts with moesin. This interaction was modeled on a demonstrated interaction between murine hamartin and human moesin.	BIND	10806479
VCAM1	CD106 \| DKFZp779G2333 \| INCAM-100 \| MGC99561	vascular cell adhesion molecule 1	-	HPRD,BioGRID	12082081
VCAM1	CD106 \| DKFZp779G2333 \| INCAM-100 \| MGC99561	vascular cell adhesion molecule 1	-	HPRD	7884872\|12082081

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION	118	78	All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON	216	144	All SZGR 2.0 genes in this pathway
PID RHOA PATHWAY	45	33	All SZGR 2.0 genes in this pathway
PID ER NONGENOMIC PATHWAY	41	35	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME L1CAM INTERACTIONS	86	62	All SZGR 2.0 genes in this pathway
REACTOME RECYCLING PATHWAY OF L1	27	15	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP	351	230	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
LANG MYB FAMILY TARGETS	29	16	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B	392	251	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER HIGH RECURRENCE	49	31	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL UP	83	51	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP	292	168	All SZGR 2.0 genes in this pathway
WU CELL MIGRATION	184	114	All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX	230	156	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC	182	116	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION UP	86	55	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN	408	274	All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP	262	186	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 8	86	57	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRCA1 VS BRCA2	163	113	All SZGR 2.0 genes in this pathway
ZHONG SECRETOME OF LUNG CANCER AND FIBROBLAST	132	93	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE UP	66	44	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
HUANG DASATINIB RESISTANCE UP	81	53	All SZGR 2.0 genes in this pathway
NUTT GBM VS AO GLIOMA UP	46	34	All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE UP	212	128	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 DN	240	153	All SZGR 2.0 genes in this pathway
HSIAO HOUSEKEEPING GENES	389	245	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1	237	159	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
DANG MYC TARGETS DN	31	25	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN	374	217	All SZGR 2.0 genes in this pathway
DEMAGALHAES AGING UP	55	39	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP	163	111	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-122	48	54	m8	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-133	140	147	1A,m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	140	147	1A,m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-192/215	1601	1607	m8	hsa-miR-192	CUGACCUAUGAAUUGACAGCC
miR-192/215	1601	1607	m8	hsa-miR-215	AUGACCUAUGAAUUGACAGAC
miR-200bc/429	1574	1581	1A,m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-217	1703	1709	m8	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-27	1794	1800	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1794	1800	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-491	43	50	1A,m8	hsa-miR-491^brain	AGUGGGGAACCCUUCCAUGAGGA
miR-96	2012	2018	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC
miR-96	2012	2018	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MSN