SZGR2

Summary ?

GeneID	4487
Symbol	MSX1
Synonyms	ECTD3\|HOX7\|HYD1\|STHAG1
Description	msh homeobox 1
Reference	MIM:142983\|HGNC:HGNC:7391\|Ensembl:ENSG00000163132\|HPRD:00866\|Vega:OTTHUMG00000090335
Gene type	protein-coding
Map location	4p16.2
Pascal p-value	0.126
Sherlock p-value	0.516
Fetal beta	0.081
DMG	2 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg07462756	4	4859985	MSX1	4.674E-4	-0.29	0.046	DMG:Wockner_2014
cg20161179	4	4863282	MSX1	5.24E-8	-0.026	1.37E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs7191772	chr16	59567415	MSX1	4487		0.19		trans
rs11094893	chrX	23186987	MSX1	4487		0.14		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0005515	protein binding	IEA		-
GO:0016564	transcription repressor activity	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030901	midbrain development	IEA	Brain (GO term level: 8)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0000122	negative regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0001501	skeletal system development	TAS		8696335
GO:0001701	in utero embryonic development	IEA		-
GO:0003007	heart morphogenesis	IEA		-
GO:0008285	negative regulation of cell proliferation	IEA		-
GO:0007517	muscle development	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0043066	negative regulation of apoptosis	IEA		-
GO:0030509	BMP signaling pathway	IEA		-
GO:0030326	embryonic limb morphogenesis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	-	HPRD,BioGRID	10215616 \|11115394
DLX2	TES-1 \| TES1	distal-less homeobox 2	Reconstituted Complex Two-hybrid	BioGRID	9111364
DLX5	-	distal-less homeobox 5	Reconstituted Complex	BioGRID	9111364
HOXC8	HOX3 \| HOX3A	homeobox C8	Reconstituted Complex	BioGRID	9111364
LHX2	LH2 \| MGC138390 \| hLhx2	LIM homeobox 2	-	HPRD,BioGRID	9697309
MSX1	HOX7 \| HYD1	msh homeobox 1	Reconstituted Complex Two-hybrid	BioGRID	9111364
MSX2	CRS2 \| FPP \| HOX8 \| MSH \| PFM \| PFM1	msh homeobox 2	-	HPRD,BioGRID	9111364
PAX3	CDHS \| HUP2 \| MGC120381 \| MGC120382 \| MGC120383 \| MGC120384 \| MGC134778 \| WS1	paired box 3	Reconstituted Complex	BioGRID	10529415
RGS7	-	regulator of G-protein signaling 7	-	HPRD	10862767
SP1	-	Sp1 transcription factor	-	HPRD,BioGRID	10215616
TAF1	BA2R \| CCG1 \| CCGS \| DYT3 \| KAT4 \| N-TAF1 \| NSCL2 \| OF \| P250 \| TAF2A \| TAFII250	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	-	HPRD,BioGRID	8700832
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	Affinity Capture-Western in vivo Phenotypic Suppression Reconstituted Complex	BioGRID	8700832 \|9111364 \|10215616
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	-	HPRD	8700832 \|10215616
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	MSX1 interacts with TP53 (p53). This interaction was modeled on a demonstrated interaction between MSX1 from an unspecified species, and human p53.	BIND	15705871

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
HOLLMANN APOPTOSIS VIA CD40 DN	267	178	All SZGR 2.0 genes in this pathway
ROY WOUND BLOOD VESSEL UP	50	30	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP	85	54	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP	146	99	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA UP	141	75	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP	162	116	All SZGR 2.0 genes in this pathway
VANHARANTA UTERINE FIBROID DN	67	45	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC	35	25	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
TESAR ALK TARGETS HUMAN ES 5D UP	5	5	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP	266	171	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
BECKER TAMOXIFEN RESISTANCE DN	52	37	All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA	176	122	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS UP	126	84	All SZGR 2.0 genes in this pathway
ZHANG TARGETS OF EWSR1 FLI1 FUSION	88	68	All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR	293	193	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA DN	41	27	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP	240	152	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP	120	89	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP	101	69	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR UP	71	48	All SZGR 2.0 genes in this pathway
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1	419	273	All SZGR 2.0 genes in this pathway
ZHU CMV 8 HR UP	47	39	All SZGR 2.0 genes in this pathway
LEIN CHOROID PLEXUS MARKERS	103	61	All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC	58	43	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN	220	147	All SZGR 2.0 genes in this pathway
TESAR ALK TARGETS EPISC 3D UP	7	7	All SZGR 2.0 genes in this pathway
TESAR ALK TARGETS EPISC 4D UP	7	6	All SZGR 2.0 genes in this pathway
TESAR ALK AND JAK TARGETS MOUSE ES D4 UP	5	5	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP	317	208	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP	461	298	All SZGR 2.0 genes in this pathway
AMUNDSON GAMMA RADIATION RESPONSE	40	25	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
HANN RESISTANCE TO BCL2 INHIBITOR DN	48	31	All SZGR 2.0 genes in this pathway
PODAR RESPONSE TO ADAPHOSTIN UP	147	98	All SZGR 2.0 genes in this pathway
TOOKER GEMCITABINE RESISTANCE DN	122	84	All SZGR 2.0 genes in this pathway
ZAIDI OSTEOBLAST TRANSCRIPTION FACTORS	14	12	All SZGR 2.0 genes in this pathway
HOFMANN MYELODYSPLASTIC SYNDROM LOW RISK UP	22	15	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	717	723	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-144	716	723	1A,m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-21	781	787	1A	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	781	787	1A	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-329	700	706	1A	hsa-miR-329^brain	AACACACCUGGUUAACCUCUUU
miR-369-3p	748	754	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	748	754	m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-495	761	767	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MSX1