SZGR2

Summary ?

GeneID	4488
Symbol	MSX2
Synonyms	CRS2\|FPP\|HOX8\|MSH\|PFM\|PFM1
Description	msh homeobox 2
Reference	MIM:123101\|HGNC:HGNC:7392\|Ensembl:ENSG00000120149\|HPRD:00421\|Vega:OTTHUMG00000130556
Gene type	protein-coding
Map location	5q35.2
Pascal p-value	0.071
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.0276
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10994209	chr10	61877705	MSX2	4488		0.06		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0005515	protein binding	IPI		12145306
GO:0043565	sequence-specific DNA binding	IDA		9073066
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001501	skeletal system development	TAS		8968743
GO:0003007	heart morphogenesis	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0008285	negative regulation of cell proliferation	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0043066	negative regulation of apoptosis	IEA		-
GO:0030509	BMP signaling pathway	IEA		-
GO:0030326	embryonic limb morphogenesis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IDA		18029348

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CEBPA	C/EBP-alpha \| CEBP	CCAAT/enhancer binding protein (C/EBP), alpha	-	HPRD,BioGRID	12925529
DLX2	TES-1 \| TES1	distal-less homeobox 2	-	HPRD,BioGRID	9111364
DLX5	-	distal-less homeobox 5	-	HPRD,BioGRID	9111364
GTF2F1	BTF4 \| RAP74 \| TF2F1 \| TFIIF	general transcription factor IIF, polypeptide 1, 74kDa	-	HPRD,BioGRID	9265625
GTF2F2	BTF4 \| RAP30 \| TF2F2 \| TFIIF	general transcription factor IIF, polypeptide 2, 30kDa	-	HPRD,BioGRID	9265625
MAGED1	DLXIN-1 \| NRAGE	melanoma antigen family D, 1	-	HPRD,BioGRID	11084035 \|11959851
MSX1	HOX7 \| HYD1	msh homeobox 1	-	HPRD,BioGRID	9111364
MSX2	CRS2 \| FPP \| HOX8 \| MSH \| PFM \| PFM1	msh homeobox 2	-	HPRD,BioGRID	9111364
PITX2	ARP1 \| Brx1 \| IDG2 \| IGDS \| IGDS2 \| IHG2 \| IRID2 \| MGC111022 \| MGC20144 \| Otlx2 \| PTX2 \| RGS \| RIEG \| RIEG1 \| RS	paired-like homeodomain 2	Phenotypic Suppression	BioGRID	11763998
RUNX2	AML3 \| CBFA1 \| CCD \| CCD1 \| MGC120022 \| MGC120023 \| OSF2 \| PEA2aA \| PEBP2A1 \| PEBP2A2 \| PEBP2aA \| PEBP2aA1	runt-related transcription factor 2	-	HPRD,BioGRID	11683913
SPEN	KIAA0929 \| MINT \| RP1-134O19.1 \| SHARP	spen homolog, transcriptional regulator (Drosophila)	-	HPRD	10451362
ZBTB17	MIZ-1 \| ZNF151 \| ZNF60 \| pHZ-67	zinc finger and BTB domain containing 17	-	HPRD	9256341

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
PUIFFE INVASION INHIBITED BY ASCITES DN	145	91	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP	450	256	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 6HR DN	167	100	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA UP	141	75	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 AND DCC TARGETS	35	25	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL	326	213	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER CLUSTER 7	20	11	All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 LASER UP	34	25	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
WILLERT WNT SIGNALING	24	13	All SZGR 2.0 genes in this pathway
OKUMURA INFLAMMATORY RESPONSE LPS	183	115	All SZGR 2.0 genes in this pathway
BECKER TAMOXIFEN RESISTANCE DN	52	37	All SZGR 2.0 genes in this pathway
KANG IMMORTALIZED BY TERT DN	102	67	All SZGR 2.0 genes in this pathway
VIETOR IFRD1 TARGETS	23	13	All SZGR 2.0 genes in this pathway
RAMASWAMY METASTASIS UP	66	43	All SZGR 2.0 genes in this pathway
KRASNOSELSKAYA ILF3 TARGETS DN	46	38	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR DN	160	101	All SZGR 2.0 genes in this pathway
SU PLACENTA	30	18	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION	88	65	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP	226	164	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
ZAIDI OSTEOBLAST TRANSCRIPTION FACTORS	14	12	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SCHRAETS MLL TARGETS UP	35	21	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER DN	134	83	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA2 UP	87	50	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
SCHMIDT POR TARGETS IN LIMB BUD DN	8	7	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-135	1096	1102	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	1096	1102	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-217	1287	1293	1A	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-329	1021	1027	1A	hsa-miR-329^brain	AACACACCUGGUUAACCUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MSX2