Gene Page: MTR
Summary ?
GeneID | 4548 |
Symbol | MTR |
Synonyms | HMAG|MS|cblG |
Description | 5-methyltetrahydrofolate-homocysteine methyltransferase |
Reference | MIM:156570|HGNC:HGNC:7468|Ensembl:ENSG00000116984|HPRD:01136|Vega:OTTHUMG00000040060 |
Gene type | protein-coding |
Map location | 1q43 |
Sherlock p-value | 0.691 |
Fetal beta | 1.049 |
eGene | Cerebellar Hemisphere Myers' cis & trans |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs350213 | chr16 | 12153373 | MTR | 4548 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008705 | methionine synthase activity | EXP | glutamate (GO term level: 7) | 8968737 |
GO:0008705 | methionine synthase activity | IEA | glutamate (GO term level: 7) | - |
GO:0004156 | dihydropteroate synthase activity | IEA | - | |
GO:0005515 | protein binding | IPI | 17353931 | |
GO:0016740 | transferase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008898 | homocysteine S-methyltransferase activity | IEA | - | |
GO:0008168 | methyltransferase activity | IEA | - | |
GO:0031419 | cobalamin binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
GO:0050897 | cobalt ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 8968737 |
GO:0009086 | methionine biosynthetic process | IEA | - | |
GO:0008652 | amino acid biosynthetic process | IEA | - | |
GO:0009396 | folic acid and derivative biosynthetic process | IEA | - | |
GO:0044237 | cellular metabolic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 8968737 | |
GO:0005622 | intracellular | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CYSTEINE AND METHIONINE METABOLISM | 34 | 24 | All SZGR 2.0 genes in this pathway |
KEGG ONE CARBON POOL BY FOLATE | 17 | 12 | All SZGR 2.0 genes in this pathway |
REACTOME SULFUR AMINO ACID METABOLISM | 24 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES | 200 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME BIOLOGICAL OXIDATIONS | 139 | 91 | All SZGR 2.0 genes in this pathway |
REACTOME PHASE II CONJUGATION | 70 | 42 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP | 128 | 95 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP | 117 | 84 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY NO BLOOD DN | 150 | 93 | All SZGR 2.0 genes in this pathway |
MARIADASON REGULATED BY HISTONE ACETYLATION DN | 54 | 30 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
NIELSEN LEIOMYOSARCOMA UP | 18 | 10 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 60 | 67 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.