Gene Page: ASTN1
Summary ?
| GeneID | 460 |
| Symbol | ASTN1 |
| Synonyms | ASTN |
| Description | astrotactin 1 |
| Reference | MIM:600904|HGNC:HGNC:773|Ensembl:ENSG00000152092|HPRD:09019|Vega:OTTHUMG00000035041 |
| Gene type | protein-coding |
| Map location | 1q25.2 |
| Sherlock p-value | 0.279 |
| Fetal beta | -0.894 |
| DMG | 1 (# studies) |
| eGene | Frontal Cortex BA9 |
| Support | STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg12268575 | 1 | 177133536 | ASTN1 | 6.18E-10 | -0.018 | 9.22E-7 | DMG:Jaffe_2016 |
| cg00319545 | 1 | 177133737 | ASTN1 | 1.92E-8 | -0.009 | 6.76E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ZFHX4 | 0.83 | 0.70 |
| ZNF521 | 0.81 | 0.54 |
| IL28RA | 0.81 | 0.45 |
| SH2D3A | 0.80 | 0.40 |
| FAM83G | 0.80 | 0.56 |
| FOXP2 | 0.80 | 0.58 |
| SCML4 | 0.79 | 0.33 |
| ALK | 0.76 | 0.42 |
| CACNA2D2 | 0.75 | 0.69 |
| NKD2 | 0.75 | 0.56 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TMEM54 | -0.29 | -0.46 |
| COX4I2 | -0.28 | -0.50 |
| C5orf53 | -0.28 | -0.48 |
| COPZ2 | -0.28 | -0.50 |
| DCN | -0.27 | -0.44 |
| AF347015.31 | -0.27 | -0.54 |
| CHPT1 | -0.27 | -0.43 |
| MYL3 | -0.27 | -0.56 |
| CA4 | -0.26 | -0.45 |
| HLA-F | -0.26 | -0.38 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007158 | neuron adhesion | NAS | neuron (GO term level: 5) | - |
| GO:0007155 | cell adhesion | IEA | - | |
| GO:0016477 | cell migration | NAS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005575 | cellular_component | ND | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| KONDO PROSTATE CANCER WITH H3K27ME3 | 196 | 93 | All SZGR 2.0 genes in this pathway |
| WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-141/200a | 983 | 990 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-182 | 2845 | 2851 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-335 | 2926 | 2932 | 1A | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
| miR-96 | 2845 | 2851 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.