Gene Page: NCAM1
Summary ?
GeneID | 4684 |
Symbol | NCAM1 |
Synonyms | CD56|MSK39|NCAM |
Description | neural cell adhesion molecule 1 |
Reference | MIM:116930|HGNC:HGNC:7656|Ensembl:ENSG00000149294|HPRD:00301|Vega:OTTHUMG00000167196 |
Gene type | protein-coding |
Map location | 11q23.1 |
Pascal p-value | 1.166E-4 |
Sherlock p-value | 0.919 |
Fetal beta | 0.625 |
eGene | Myers' cis & trans |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0233 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6733654 | chr2 | 1963270 | NCAM1 | 4684 | 0.12 | trans | ||
rs17029291 | chr3 | 32402138 | NCAM1 | 4684 | 6.899E-6 | trans | ||
rs1553189 | chr3 | 112939422 | NCAM1 | 4684 | 0.18 | trans | ||
rs10992675 | chr9 | 95963315 | NCAM1 | 4684 | 0.2 | trans | ||
rs4607971 | chr10 | 19407890 | NCAM1 | 4684 | 0.07 | trans | ||
rs7111397 | chr11 | 20133985 | NCAM1 | 4684 | 0.12 | trans | ||
rs1761450 | chr19 | 54818034 | NCAM1 | 4684 | 0.07 | trans | ||
rs6040268 | chr20 | 10956100 | NCAM1 | 4684 | 0.14 | trans | ||
rs6040269 | chr20 | 10956136 | NCAM1 | 4684 | 0.14 | trans | ||
rs11906936 | chr20 | 10957136 | NCAM1 | 4684 | 0.14 | trans | ||
rs1327232 | chr20 | 10958909 | NCAM1 | 4684 | 0.12 | trans | ||
rs12157904 | chr22 | 37982011 | NCAM1 | 4684 | 0.06 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MRPL21 | 0.89 | 0.82 |
JTB | 0.89 | 0.77 |
C14orf2 | 0.87 | 0.74 |
MRPL33 | 0.86 | 0.65 |
UQCRQ | 0.86 | 0.71 |
C17orf61 | 0.86 | 0.70 |
COX5A | 0.86 | 0.72 |
NDUFA2 | 0.85 | 0.72 |
HAX1 | 0.85 | 0.73 |
AC009171.1 | 0.85 | 0.73 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MYH9 | -0.47 | -0.42 |
BAT2D1 | -0.43 | -0.37 |
MMRN2 | -0.42 | -0.40 |
PLEC1 | -0.41 | -0.44 |
PRX | -0.39 | -0.45 |
ITIH5 | -0.39 | -0.42 |
Z83840.4 | -0.39 | -0.45 |
AC010300.1 | -0.38 | -0.57 |
KIF16B | -0.38 | -0.38 |
RRBP1 | -0.38 | -0.45 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | IEA | - | |
GO:0007155 | cell adhesion | NAS | 10770948 | |
GO:0007166 | cell surface receptor linked signal transduction | IEA | - | |
GO:0034109 | homotypic cell-cell adhesion | IEA | - | |
GO:0050850 | positive regulation of calcium-mediated signaling | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
GO:0005576 | extracellular region | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | TAS | 3576199 | |
GO:0009897 | external side of plasma membrane | IEA | - | |
GO:0005886 | plasma membrane | TAS | 3576199 | |
GO:0031225 | anchored to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
KEGG PRION DISEASES | 35 | 28 | All SZGR 2.0 genes in this pathway |
PID FGF PATHWAY | 55 | 37 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME NCAM1 INTERACTIONS | 39 | 27 | All SZGR 2.0 genes in this pathway |
REACTOME NCAM SIGNALING FOR NEURITE OUT GROWTH | 64 | 49 | All SZGR 2.0 genes in this pathway |
REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNAL TRANSDUCTION BY L1 | 34 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON GAMMA SIGNALING | 63 | 48 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON SIGNALING | 159 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
JAEGER METASTASIS UP | 44 | 23 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
HAHTOLA SEZARY SYNDROM DN | 42 | 26 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP | 126 | 72 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 UP | 120 | 73 | All SZGR 2.0 genes in this pathway |
CASTELLANO NRAS TARGETS DN | 14 | 14 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS A UP | 191 | 128 | All SZGR 2.0 genes in this pathway |
SILIGAN TARGETS OF EWS FLI1 FUSION UP | 15 | 12 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
DAWSON METHYLATED IN LYMPHOMA TCL1 | 59 | 45 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 2 UP | 30 | 24 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM5 | 94 | 59 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
WOTTON RUNX TARGETS UP | 21 | 14 | All SZGR 2.0 genes in this pathway |
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION UP | 69 | 55 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
ROZANOV MMP14 TARGETS UP | 266 | 171 | All SZGR 2.0 genes in this pathway |
LEI HOXC8 TARGETS DN | 17 | 13 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
YAO HOXA10 TARGETS VIA PROGESTERONE UP | 79 | 58 | All SZGR 2.0 genes in this pathway |
WANG TARGETS OF MLL CBP FUSION UP | 44 | 26 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
YAGI AML FAB MARKERS | 191 | 131 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
RAMALHO STEMNESS DN | 74 | 55 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS UP | 37 | 27 | All SZGR 2.0 genes in this pathway |
PAL PRMT5 TARGETS UP | 203 | 135 | All SZGR 2.0 genes in this pathway |
MODY HIPPOCAMPUS NEONATAL | 35 | 25 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
KIM GASTRIC CANCER CHEMOSENSITIVITY | 103 | 64 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 8 | 86 | 57 | All SZGR 2.0 genes in this pathway |
TAKAO RESPONSE TO UVB RADIATION DN | 98 | 67 | All SZGR 2.0 genes in this pathway |
KUNINGER IGF1 VS PDGFB TARGETS UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
SIMBULAN PARP1 TARGETS DN | 17 | 10 | All SZGR 2.0 genes in this pathway |
JI CARCINOGENESIS BY KRAS AND STK11 DN | 17 | 12 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE BPA E2 | 118 | 65 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
RAY TUMORIGENESIS BY ERBB2 CDC25A UP | 104 | 57 | All SZGR 2.0 genes in this pathway |
MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
NUTT GBM VS AO GLIOMA DN | 45 | 22 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA2 UP | 87 | 50 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 0 | 76 | 54 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
IKEDA MIR30 TARGETS UP | 116 | 87 | All SZGR 2.0 genes in this pathway |
IKEDA MIR30 TARGETS DN | 27 | 24 | All SZGR 2.0 genes in this pathway |
ABDELMOHSEN ELAVL4 TARGETS | 16 | 13 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 1262 | 1268 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-128 | 1902 | 1908 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU | ||||
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-136 | 1976 | 1982 | m8 | hsa-miR-136 | ACUCCAUUUGUUUUGAUGAUGGA |
miR-148/152 | 1532 | 1538 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-182 | 611 | 617 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-204/211 | 1459 | 1465 | 1A | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
miR-205 | 1083 | 1089 | 1A | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
miR-27 | 1902 | 1909 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-30-5p | 721 | 728 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG | ||||
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-377 | 1558 | 1564 | 1A | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-378 | 1647 | 1653 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-381 | 1123 | 1129 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU | ||||
miR-384 | 333 | 339 | m8 | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
miR-505 | 1102 | 1108 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
miR-539 | 1954 | 1960 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
miR-96 | 611 | 617 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.