Gene Page: NDUFAB1
Summary ?
GeneID | 4706 |
Symbol | NDUFAB1 |
Synonyms | ACP|FASN2A|SDAP |
Description | NADH:ubiquinone oxidoreductase subunit AB1 |
Reference | MIM:603836|HGNC:HGNC:7694|Ensembl:ENSG00000004779|HPRD:11951|Vega:OTTHUMG00000096985 |
Gene type | protein-coding |
Map location | 16p12.2 |
Pascal p-value | 0.088 |
Sherlock p-value | 0.175 |
Fetal beta | -0.604 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 | |
Expression | Meta-analysis of gene expression | P value: 1.68 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7132043 | chr12 | 80968399 | NDUFAB1 | 4706 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000036 | acyl carrier activity | NAS | 10234612 | |
GO:0005504 | fatty acid binding | ISS | - | |
GO:0005509 | calcium ion binding | NAS | 10234612 | |
GO:0008137 | NADH dehydrogenase (ubiquinone) activity | NAS | 9878551 | |
GO:0048037 | cofactor binding | IEA | - | |
GO:0031177 | phosphopantetheine binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006120 | mitochondrial electron transport, NADH to ubiquinone | NAS | 9878551 | |
GO:0006810 | transport | IEA | - | |
GO:0006633 | fatty acid biosynthetic process | NAS | 10234612 | |
GO:0022900 | electron transport chain | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005739 | mitochondrion | IEA | - | |
GO:0005747 | mitochondrial respiratory chain complex I | ISS | - | |
GO:0005747 | mitochondrial respiratory chain complex I | NAS | 9878551 | |
GO:0005759 | mitochondrial matrix | ISS | - | |
GO:0031966 | mitochondrial membrane | ISS | - | |
GO:0031966 | mitochondrial membrane | NAS | 10234612 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG OXIDATIVE PHOSPHORYLATION | 135 | 73 | All SZGR 2.0 genes in this pathway |
KEGG ALZHEIMERS DISEASE | 169 | 110 | All SZGR 2.0 genes in this pathway |
KEGG PARKINSONS DISEASE | 133 | 78 | All SZGR 2.0 genes in this pathway |
KEGG HUNTINGTONS DISEASE | 185 | 109 | All SZGR 2.0 genes in this pathway |
REACTOME TCA CYCLE AND RESPIRATORY ELECTRON TRANSPORT | 141 | 85 | All SZGR 2.0 genes in this pathway |
REACTOME RESPIRATORY ELECTRON TRANSPORT | 79 | 44 | All SZGR 2.0 genes in this pathway |
REACTOME RESPIRATORY ELECTRON TRANSPORT ATP SYNTHESIS BY CHEMIOSMOTIC COUPLING AND HEAT PRODUCTION BY UNCOUPLING PROTEINS | 98 | 56 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP | 204 | 140 | All SZGR 2.0 genes in this pathway |
LANDIS ERBB2 BREAST PRENEOPLASTIC DN | 55 | 33 | All SZGR 2.0 genes in this pathway |
LANDIS ERBB2 BREAST TUMORS 324 DN | 149 | 93 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 5 6WK DN | 137 | 97 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 6 7WK UP | 197 | 135 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
GOLDRATH HOMEOSTATIC PROLIFERATION | 171 | 102 | All SZGR 2.0 genes in this pathway |
MOOTHA VOXPHOS | 87 | 51 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
RAMALHO STEMNESS UP | 206 | 118 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 5 | 126 | 78 | All SZGR 2.0 genes in this pathway |
YIH RESPONSE TO ARSENITE C3 | 36 | 24 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
WONG MITOCHONDRIA GENE MODULE | 217 | 122 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
BHATI G2M ARREST BY 2METHOXYESTRADIOL UP | 125 | 68 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 13 | 172 | 107 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17 | 181 | 101 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-381 | 115 | 121 | m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.