Gene Page: NFIA
Summary ?
GeneID | 4774 |
Symbol | NFIA |
Synonyms | CTF|NF-I/A|NF1-A|NFI-A|NFI-L |
Description | nuclear factor I/A |
Reference | MIM:600727|HGNC:HGNC:7784|Ensembl:ENSG00000162599|HPRD:09007|Vega:OTTHUMG00000008618 |
Gene type | protein-coding |
Map location | 1p31.3-p31.2 |
Pascal p-value | 0.013 |
Sherlock p-value | 0.944 |
Fetal beta | 2.414 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 | |
Expression | Meta-analysis of gene expression | P value: 2.002 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04093972 | 1 | 61516130 | NFIA | 2.62E-9 | -0.015 | 1.91E-6 | DMG:Jaffe_2016 |
cg02444243 | 1 | 61516135 | NFIA | 2.61E-8 | -0.028 | 8.35E-6 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs3739804 | chr9 | 87421630 | NFIA | 4774 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0003700 | transcription factor activity | NAS | 7590749 | |
GO:0008134 | transcription factor binding | IPI | 15684392 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006355 | regulation of transcription, DNA-dependent | NAS | 7590749 | |
GO:0006350 | transcription | IEA | - | |
GO:0006260 | DNA replication | IEA | - | |
GO:0019079 | viral genome replication | NAS | 7590749 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | IDA | 15684392 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005634 | nucleus | NAS | 7590749 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID HNF3A PATHWAY | 44 | 29 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 3 4WK DN | 39 | 27 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION 6HR | 40 | 23 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 5 | 147 | 89 | All SZGR 2.0 genes in this pathway |
KAUFFMANN MELANOMA RELAPSE DN | 6 | 6 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX4 DN | 32 | 22 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN | 103 | 64 | All SZGR 2.0 genes in this pathway |
KAUFFMANN DNA REPLICATION GENES | 147 | 87 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
ZAMORA NOS2 TARGETS DN | 96 | 71 | All SZGR 2.0 genes in this pathway |
HOWLIN CITED1 TARGETS 2 UP | 17 | 10 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
TAYLOR METHYLATED IN ACUTE LYMPHOBLASTIC LEUKEMIA | 77 | 52 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D CLUSTER UP | 27 | 19 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD2 DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
NAKAMURA ADIPOGENESIS LATE UP | 104 | 67 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE M G1 | 148 | 95 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN | 106 | 77 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 647 | 654 | 1A,m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-200bc/429 | 325 | 331 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-217 | 478 | 484 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-223 | 752 | 759 | 1A,m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
miR-25/32/92/363/367 | 798 | 804 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-29 | 181 | 187 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-338 | 184 | 190 | 1A | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
miR-381 | 966 | 972 | m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-382 | 30 | 36 | m8 | hsa-miR-382brain | GAAGUUGUUCGUGGUGGAUUCG |
miR-505 | 842 | 848 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
miR-93.hd/291-3p/294/295/302/372/373/520 | 652 | 658 | 1A | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.