SZGR2

Summary ?

GeneID	4790
Symbol	NFKB1
Synonyms	CVID12\|EBP-1\|KBF1\|NF-kB1\|NF-kappa-B\|NF-kappaB\|NFKB-p105\|NFKB-p50\|NFkappaB\|p105\|p50
Description	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Reference	MIM:164011\|HGNC:HGNC:7794\|Ensembl:ENSG00000109320\|HPRD:01238\|Vega:OTTHUMG00000161080
Gene type	protein-coding
Map location	4q24
Pascal p-value	0.113
Sherlock p-value	0.112
Fetal beta	-0.303
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0798

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
OLIG1	0.82	0.89
OLIG2	0.81	0.86
SOX10	0.75	0.87
HEPACAM	0.71	0.81
ZCCHC24	0.71	0.81
NFATC1	0.70	0.67
CHAD	0.70	0.77
SLC12A4	0.69	0.63
PRR5L	0.69	0.65
CD82	0.68	0.72

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
STMN1	-0.45	-0.56
STMN2	-0.44	-0.55
MAPK8	-0.44	-0.52
POLB	-0.44	-0.59
ZNF551	-0.44	-0.52
ZNF286	-0.44	-0.49
PPP3CC	-0.43	-0.54
AC004017.1	-0.43	-0.50
MED19	-0.43	-0.56
FRG1	-0.43	-0.61

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	TAS		10928981
GO:0005515	protein binding	IPI		8196632 \|11526476 \|14624448 \|16108830 \|16306601
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006366	transcription from RNA polymerase II promoter	TAS		1992489
GO:0007165	signal transduction	IEA		-
GO:0006954	inflammatory response	TAS		1992489
GO:0006916	anti-apoptosis	TAS		10811897
GO:0006915	apoptosis	IEA		-
GO:0045941	positive regulation of transcription	NAS		8096091
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	EXP		10723127
GO:0005634	nucleus	IDA		11819787
GO:0005654	nucleoplasm	EXP		10723127
GO:0005737	cytoplasm	IDA		11819787

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD	8798655
ATF3	-	activating transcription factor 3	-	HPRD	7692236
BCL3	BCL4 \| D19S37	B-cell CLL/lymphoma 3	p50 interacts with BCL-3. This interaction was modelled on a demonstrated interaction between p50 from an unspecified species and human BCL-3.	BIND	15469820
BCL3	BCL4 \| D19S37	B-cell CLL/lymphoma 3	-	HPRD	10362352
BCL3	BCL4 \| D19S37	B-cell CLL/lymphoma 3	Affinity Capture-Western Co-localization Co-purification Reconstituted Complex	BioGRID	8428580 \|10469655 \|14678988
BCL3	BCL4 \| D19S37	B-cell CLL/lymphoma 3	NFKB1 (p50) interacts with BCL3.	BIND	15829968
BIRC3	AIP1 \| API2 \| CIAP2 \| HAIP1 \| HIAP1 \| MALT2 \| MIHC \| RNF49	baculoviral IAP repeat-containing 3	The cIAP-2 promoter interacts with p50.	BIND	15494311
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD	12700228
BTRC	BETA-TRCP \| FBW1A \| FBXW1 \| FBXW1A \| FWD1 \| MGC4643 \| bTrCP \| bTrCP1 \| betaTrCP	beta-transducin repeat containing	Affinity Capture-Western	BioGRID	11158290
CD82	4F9 \| C33 \| GR15 \| IA4 \| KAI1 \| R2 \| SAR2 \| ST6 \| TSPAN27	CD82 molecule	NFKB1 (p50) interacts with the CD82 (KAI1) promoter.	BIND	15829968
CDK9	C-2k \| CDC2L4 \| CTK1 \| PITALRE \| TAK	cyclin-dependent kinase 9	-	HPRD	12173051
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD,BioGRID	1518839
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	-	HPRD,BioGRID	10469655
COPB2	beta'-COP	coatomer protein complex, subunit beta 2 (beta prime)	Affinity Capture-MS	BioGRID	14743216
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	NFKB1 (p50) interacts with CTNNB1 (beta-catenin).	BIND	15829968
DSP	DPI \| DPII	desmoplakin	-	HPRD	14743216
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	Reconstituted Complex	BioGRID	9368006
ELF1	-	E74-like factor 1 (ets domain transcription factor)	-	HPRD,BioGRID	7862168
ELF3	EPR-1 \| ERT \| ESE-1 \| ESX	E74-like factor 3 (ets domain transcription factor, epithelial-specific )	-	HPRD,BioGRID	11036073
ETS1	ETS-1 \| EWSR2 \| FLJ10768	v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)	-	HPRD	9094628
FOS	AP-1 \| C-FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog	-	HPRD	9468519
G3BP2	-	GTPase activating protein (SH3 domain) binding protein 2	-	HPRD	10969074
GSK3B	-	glycogen synthase kinase 3 beta	-	HPRD,BioGRID	11425860
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD,BioGRID	11931769
HMGA2	BABL \| HMGI-C \| HMGIC \| LIPO \| STQTL9	high mobility group AT-hook 2	-	HPRD,BioGRID	12693954
HMGB1	DKFZp686A04236 \| HMG1 \| HMG3 \| SBP-1	high-mobility group box 1	-	HPRD,BioGRID	12604365
HNRNPM	DKFZp547H118 \| HNRNPM4 \| HNRPM \| HNRPM4 \| HTGR1 \| NAGR1	heterogeneous nuclear ribonucleoprotein M	-	HPRD	14743216
HSPA8	HSC54 \| HSC70 \| HSC71 \| HSP71 \| HSP73 \| HSPA10 \| LAP1 \| MGC131511 \| MGC29929 \| NIP71	heat shock 70kDa protein 8	-	HPRD	14743216
IKBKB	FLJ40509 \| IKK-beta \| IKK2 \| IKKB \| MGC131801 \| NFKBIKB	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	-	HPRD	10469655\|11158290
IKBKB	FLJ40509 \| IKK-beta \| IKK2 \| IKKB \| MGC131801 \| NFKBIKB	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	Affinity Capture-Western Biochemical Activity	BioGRID	10469655 \|11158290
IKBKG	AMCBX1 \| FIP-3 \| FIP3 \| Fip3p \| IKK-gamma \| IP \| IP1 \| IP2 \| IPD2 \| NEMO	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma	Affinity Capture-MS	BioGRID	14743216
IL2RA	CD25 \| IDDM10 \| IL2R \| TCGFR	interleukin 2 receptor, alpha	in vitro in vivo	BioGRID	2497520
IL8	CXCL8 \| GCP-1 \| GCP1 \| LECT \| LUCT \| LYNAP \| MDNCF \| MONAP \| NAF \| NAP-1 \| NAP1	interleukin 8	The IL-8 promoter interacts with p50.	BIND	15494311
IRF1	IRF-1 \| MAR	interferon regulatory factor 1	-	HPRD	8746784
IRF2	DKFZp686F0244 \| IRF-2	interferon regulatory factor 2	-	HPRD,BioGRID	8550813
ITGB3BP	CENP-R \| CENPR \| HSU37139 \| NRIF3 \| TAP20	integrin beta 3 binding protein (beta3-endonexin)	-	HPRD,BioGRID	12244126
KAT5	ESA1 \| HTATIP \| HTATIP1 \| PLIP \| TIP \| TIP60 \| cPLA2	K(lysine) acetyltransferase 5	HTATIP (Tip60) interacts with NFKB1 (p50).	BIND	15829968
KLF5	BTEB2 \| CKLF \| IKLF	Kruppel-like factor 5 (intestinal)	-	HPRD,BioGRID	14573617
KPNA3	IPOA4 \| SRP1gamma \| SRP4 \| hSRP1	karyopherin alpha 3 (importin alpha 4)	Affinity Capture-MS	BioGRID	14743216
LYL1	bHLHa18	lymphoblastic leukemia derived sequence 1	in vitro in vivo Two-hybrid	BioGRID	10023675
MAP3K7IP2	FLJ21885 \| KIAA0733 \| TAB2	mitogen-activated protein kinase kinase kinase 7 interacting protein 2	Affinity Capture-Western Reconstituted Complex	BioGRID	12150997
MAP3K8	COT \| EST \| ESTF \| FLJ10486 \| TPL2 \| Tpl-2 \| c-COT	mitogen-activated protein kinase kinase kinase 8	-	HPRD,BioGRID	9950430
MEN1	MEAI \| SCG2	multiple endocrine neoplasia I	-	HPRD,BioGRID	11526476
MRCL3	MLCB \| MRLC3	myosin regulatory light chain MRCL3	-	HPRD	14743216
MTPN	FLJ31098 \| FLJ99857 \| GCDP \| V-1	myotrophin	-	HPRD,BioGRID	11971907
MYL6	ESMLC \| LC17-GI \| LC17-NM \| LC17A \| LC17B \| MLC1SM \| MLC3NM \| MLC3SM	myosin, light chain 6, alkali, smooth muscle and non-muscle	-	HPRD	14743216
NCF1C	SH3PXD1C	neutrophil cytosolic factor 1C pseudogene	-	HPRD	12618429
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	SRC-1 interacts with p50. This interaction is modelled on a demonstrated interaction between human SRC-1 and p50 from an unspecified species.	BIND	9556555
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD,BioGRID	9556555
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	Reconstituted Complex	BioGRID	10847592
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	Affinity Capture-Western	BioGRID	12150997
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	-	HPRD	10777532
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	Affinity Capture-MS Affinity Capture-Western Co-localization Reconstituted Complex	BioGRID	8428580 \|14743216
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	NFKB1 (p50) forms a homodimer.	BIND	15735750
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	p50 interacts with p50. This interaction was modelled on a demonstrated interaction between p50 and p50 both from an unspecified species.	BIND	9556555
NFKB2	LYT-10 \| LYT10	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	Affinity Capture-MS	BioGRID	14743216
NFKBIA	IKBA \| MAD-3 \| NFKBI	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	-	HPRD,BioGRID	9738011
NFKBIA	IKBA \| MAD-3 \| NFKBI	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	p50 associates with I-kappa-B-alpha.	BIND	9135156
NFKBIE	IKBE	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	-	HPRD	9223487
NFKBIE	IKBE	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9315679
NFKBIZ	FLJ30225 \| FLJ34463 \| IKBZ \| INAP \| MAIL	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	Affinity Capture-Western	BioGRID	11356851
NKRF	ITBA4 \| NRF	NFKB repressing factor	Reconstituted Complex	BioGRID	10562553
NOTCH1	TAN1 \| hN1	Notch homolog 1, translocation-associated (Drosophila)	-	HPRD,BioGRID	8642313 \|11418662
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD,BioGRID	7823959 \|8290595
PARP1	ADPRT \| ADPRT1 \| PARP \| PARP-1 \| PPOL \| pADPRT-1	poly (ADP-ribose) polymerase 1	-	HPRD	11590148
PPP4C	PP4 \| PPH3 \| PPX	protein phosphatase 4 (formerly X), catalytic subunit	-	HPRD,BioGRID	9837938
REL	C-Rel	v-rel reticuloendotheliosis viral oncogene homolog (avian)	Affinity Capture-MS	BioGRID	14743216
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	Affinity Capture-MS Reconstituted Complex	BioGRID	8798655 \|14743216
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	NFKB1 (p50) interacts with RELA (p65).	BIND	15735750
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	p50 interacts with p65. This interaction was modeled on a demonstrated interaction between mouse p50 and mouse p65.	BIND	9738011
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	-	HPRD	8649779
RELB	I-REL \| IREL	v-rel reticuloendotheliosis viral oncogene homolog B	Affinity Capture-MS	BioGRID	14743216
RSF1	HBXAP \| RSF-1 \| XAP8 \| p325	remodeling and spacing factor 1	-	HPRD,BioGRID	15242768
RUVBL2	CGI-46 \| ECP51 \| INO80J \| REPTIN \| RVB2 \| TIH2 \| TIP48 \| TIP49B	RuvB-like 2 (E. coli)	-	HPRD	14743216
RUVBL2	CGI-46 \| ECP51 \| INO80J \| REPTIN \| RVB2 \| TIH2 \| TIP48 \| TIP49B	RuvB-like 2 (E. coli)	NFKB1 (p50) interacts with RUVBL2 (reptin).	BIND	15829968
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	-	HPRD,BioGRID	10075655
SP1	-	Sp1 transcription factor	Reconstituted Complex	BioGRID	7933095
SPAG9	FLJ13450 \| FLJ14006 \| FLJ26141 \| FLJ34602 \| HLC4 \| JLP \| KIAA0516 \| MGC117291 \| MGC14967 \| MGC74461 \| PHET \| PIG6	sperm associated antigen 9	-	HPRD,BioGRID	14743216
SPAG9	FLJ13450 \| FLJ14006 \| FLJ26141 \| FLJ34602 \| HLC4 \| JLP \| KIAA0516 \| MGC117291 \| MGC14967 \| MGC74461 \| PHET \| PIG6	sperm associated antigen 9	NFKB1 (NF-kB1/p105) interacts with an unspecified isoform of SPAG9 (JLP).	BIND	14743216
SPI1	OF \| PU.1 \| SFPI1 \| SPI-1 \| SPI-A	spleen focus forming virus (SFFV) proviral integration oncogene spi1	-	HPRD	9094628
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	-	HPRD,BioGRID	12057007
STAT6	D12S1644 \| IL-4-STAT \| STAT6B \| STAT6C	signal transducer and activator of transcription 6, interleukin-4 induced	-	HPRD,BioGRID	9584180
TBK1	FLJ11330 \| NAK \| T2K	TANK-binding kinase 1	Affinity Capture-MS	BioGRID	14743216
TNFSF11	CD254 \| ODF \| OPGL \| OPTB2 \| RANKL \| TRANCE \| hRANKL2 \| sOdf	tumor necrosis factor (ligand) superfamily, member 11	-	HPRD	10635328
TNIP2	ABIN-2 \| ABIN2 \| FLIP1 \| KLIP \| MGC4289	TNFAIP3 interacting protein 2	-	HPRD,BioGRID	14743216 \|15169888
TNIP3	ABIN-3 \| FLJ21162 \| LIND	TNFAIP3 interacting protein 3	Affinity Capture-MS	BioGRID	14743216
TP53BP1	53BP1 \| FLJ41424 \| MGC138366 \| p202	tumor protein p53 binding protein 1	Affinity Capture-Western	BioGRID	10646849
TPR	-	translocated promoter region (to activated MET oncogene)	-	HPRD	14743216
TRIP4	HsT17391	thyroid hormone receptor interactor 4	-	HPRD	12077347
TSC22D3	DIP \| DKFZp313A1123 \| DSIPI \| GILZ \| TSC-22R \| hDIP	TSC22 domain family, member 3	-	HPRD,BioGRID	11468175
TUBA3C	TUBA2 \| bA408E5.3	tubulin, alpha 3c	-	HPRD	14743216
TUBB2B	DKFZp566F223 \| FLJ98847 \| MGC8685 \| TUBB-PARALOG \| bA506K6.1	tubulin, beta 2B	-	HPRD	14743216
TUBB6	HsT1601 \| MGC132410 \| MGC4083 \| TUBB-5	tubulin, beta 6	-	HPRD	14743216
TXN	DKFZp686B1993 \| MGC61975 \| TRX \| TRX1	thioredoxin	-	HPRD,BioGRID	7788295
UBE2K	DKFZp564C1216 \| DKFZp686J24237 \| E2-25K \| HIP2 \| HYPG \| LIG	ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)	-	HPRD	9535861
UNC5CL	MGC34763 \| ZUD	unc-5 homolog C (C. elegans)-like	-	HPRD,BioGRID	14769797

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG APOPTOSIS	88	62	All SZGR 2.0 genes in this pathway
KEGG TOLL LIKE RECEPTOR SIGNALING PATHWAY	102	88	All SZGR 2.0 genes in this pathway
KEGG NOD LIKE RECEPTOR SIGNALING PATHWAY	62	47	All SZGR 2.0 genes in this pathway
KEGG RIG I LIKE RECEPTOR SIGNALING PATHWAY	71	51	All SZGR 2.0 genes in this pathway
KEGG CYTOSOLIC DNA SENSING PATHWAY	56	44	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG B CELL RECEPTOR SIGNALING PATHWAY	75	56	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG ADIPOCYTOKINE SIGNALING PATHWAY	67	57	All SZGR 2.0 genes in this pathway
KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION	68	44	All SZGR 2.0 genes in this pathway
KEGG LEISHMANIA INFECTION	72	56	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER	70	56	All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER	89	75	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
KEGG ACUTE MYELOID LEUKEMIA	60	47	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
BIOCARTA RELA PATHWAY	16	12	All SZGR 2.0 genes in this pathway
BIOCARTA AKT PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA ATM PATHWAY	20	16	All SZGR 2.0 genes in this pathway
BIOCARTA RANKL PATHWAY	14	13	All SZGR 2.0 genes in this pathway
BIOCARTA CDMAC PATHWAY	16	15	All SZGR 2.0 genes in this pathway
BIOCARTA CD40 PATHWAY	15	13	All SZGR 2.0 genes in this pathway
BIOCARTA CERAMIDE PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA TID PATHWAY	19	15	All SZGR 2.0 genes in this pathway
BIOCARTA GCR PATHWAY	22	17	All SZGR 2.0 genes in this pathway
BIOCARTA CXCR4 PATHWAY	24	22	All SZGR 2.0 genes in this pathway
BIOCARTA RNA PATHWAY	10	9	All SZGR 2.0 genes in this pathway
BIOCARTA EPONFKB PATHWAY	11	11	All SZGR 2.0 genes in this pathway
BIOCARTA FMLP PATHWAY	39	29	All SZGR 2.0 genes in this pathway
BIOCARTA FREE PATHWAY	10	7	All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA HCMV PATHWAY	17	16	All SZGR 2.0 genes in this pathway
BIOCARTA GSK3 PATHWAY	27	26	All SZGR 2.0 genes in this pathway
BIOCARTA DEATH PATHWAY	33	24	All SZGR 2.0 genes in this pathway
BIOCARTA RACCYCD PATHWAY	26	23	All SZGR 2.0 genes in this pathway
BIOCARTA KERATINOCYTE PATHWAY	46	38	All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY	87	68	All SZGR 2.0 genes in this pathway
BIOCARTA VIP PATHWAY	29	26	All SZGR 2.0 genes in this pathway
BIOCARTA NTHI PATHWAY	24	20	All SZGR 2.0 genes in this pathway
BIOCARTA NFKB PATHWAY	23	19	All SZGR 2.0 genes in this pathway
BIOCARTA RAS PATHWAY	23	20	All SZGR 2.0 genes in this pathway
BIOCARTA CARDIACEGF PATHWAY	18	16	All SZGR 2.0 genes in this pathway
BIOCARTA IL1R PATHWAY	33	29	All SZGR 2.0 genes in this pathway
BIOCARTA TCR PATHWAY	49	37	All SZGR 2.0 genes in this pathway
BIOCARTA TALL1 PATHWAY	15	15	All SZGR 2.0 genes in this pathway
BIOCARTA 41BB PATHWAY	17	15	All SZGR 2.0 genes in this pathway
BIOCARTA STRESS PATHWAY	25	18	All SZGR 2.0 genes in this pathway
BIOCARTA TNFR2 PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA TOLL PATHWAY	37	31	All SZGR 2.0 genes in this pathway
ST TUMOR NECROSIS FACTOR PATHWAY	29	20	All SZGR 2.0 genes in this pathway
ST ERK1 ERK2 MAPK PATHWAY	32	25	All SZGR 2.0 genes in this pathway
SIG CD40PATHWAYMAP	34	28	All SZGR 2.0 genes in this pathway
ST P38 MAPK PATHWAY	37	28	All SZGR 2.0 genes in this pathway
ST GAQ PATHWAY	28	22	All SZGR 2.0 genes in this pathway
ST GA13 PATHWAY	37	32	All SZGR 2.0 genes in this pathway
ST T CELL SIGNAL TRANSDUCTION	45	33	All SZGR 2.0 genes in this pathway
ST B CELL ANTIGEN RECEPTOR	40	32	All SZGR 2.0 genes in this pathway
ST FAS SIGNALING PATHWAY	65	54	All SZGR 2.0 genes in this pathway
PID FCER1 PATHWAY	62	43	All SZGR 2.0 genes in this pathway
PID BCR 5PATHWAY	65	50	All SZGR 2.0 genes in this pathway
PID LYSOPHOSPHOLIPID PATHWAY	66	53	All SZGR 2.0 genes in this pathway
PID NFKAPPAB ATYPICAL PATHWAY	17	15	All SZGR 2.0 genes in this pathway
PID NFKAPPAB CANONICAL PATHWAY	23	20	All SZGR 2.0 genes in this pathway
PID CD40 PATHWAY	31	26	All SZGR 2.0 genes in this pathway
PID IL12 2PATHWAY	63	54	All SZGR 2.0 genes in this pathway
PID AVB3 OPN PATHWAY	31	29	All SZGR 2.0 genes in this pathway
PID ANGIOPOIETIN RECEPTOR PATHWAY	50	41	All SZGR 2.0 genes in this pathway
PID HDAC CLASSI PATHWAY	66	50	All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY	68	48	All SZGR 2.0 genes in this pathway
PID IL1 PATHWAY	34	28	All SZGR 2.0 genes in this pathway
PID REG GR PATHWAY	82	60	All SZGR 2.0 genes in this pathway
PID TNF PATHWAY	46	33	All SZGR 2.0 genes in this pathway
PID IL2 PI3K PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID CERAMIDE PATHWAY	48	37	All SZGR 2.0 genes in this pathway
PID AMB2 NEUTROPHILS PATHWAY	41	32	All SZGR 2.0 genes in this pathway
PID IL23 PATHWAY	37	30	All SZGR 2.0 genes in this pathway
PID HIV NEF PATHWAY	35	26	All SZGR 2.0 genes in this pathway
PID EPO PATHWAY	34	29	All SZGR 2.0 genes in this pathway
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE UP	108	67	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP	214	155	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR DN	209	122	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
NUNODA RESPONSE TO DASATINIB IMATINIB UP	29	20	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 XPCS DN	88	71	All SZGR 2.0 genes in this pathway
GILMORE CORE NFKB PATHWAY	14	10	All SZGR 2.0 genes in this pathway
SCHEIDEREIT IKK TARGETS	18	15	All SZGR 2.0 genes in this pathway
LI LUNG CANCER	41	30	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DIRMEIER LMP1 RESPONSE LATE UP	57	41	All SZGR 2.0 genes in this pathway
YAN ESCAPE FROM ANOIKIS	24	19	All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION	149	101	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 3	28	23	All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP	223	140	All SZGR 2.0 genes in this pathway
MORI PRE BI LYMPHOCYTE DN	77	49	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS	185	114	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS B LYMPHOCYTE DN	38	25	All SZGR 2.0 genes in this pathway
BYSTROEM CORRELATED WITH IL5 UP	51	30	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
MAGRANGEAS MULTIPLE MYELOMA IGLL VS IGLK UP	42	24	All SZGR 2.0 genes in this pathway
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN	85	67	All SZGR 2.0 genes in this pathway
NEMETH INFLAMMATORY RESPONSE LPS UP	88	64	All SZGR 2.0 genes in this pathway
ABRAHAM ALPC VS MULTIPLE MYELOMA UP	26	22	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND UP	77	52	All SZGR 2.0 genes in this pathway
RADMACHER AML PROGNOSIS	78	52	All SZGR 2.0 genes in this pathway
IYENGAR RESPONSE TO ADIPOCYTE FACTORS	10	8	All SZGR 2.0 genes in this pathway
NATSUME RESPONSE TO INTERFERON BETA UP	71	49	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS RESPONSE	35	28	All SZGR 2.0 genes in this pathway
ZHOU TNF SIGNALING 4HR	54	36	All SZGR 2.0 genes in this pathway
HARRIS HYPOXIA	81	64	All SZGR 2.0 genes in this pathway
PAL PRMT5 TARGETS UP	203	135	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE DN	123	76	All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP	120	89	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR UP	93	65	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
NIKOLSKY OVERCONNECTED IN BREAST CANCER	22	19	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN	354	216	All SZGR 2.0 genes in this pathway
GAURNIER PSMD4 TARGETS	73	55	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE	242	168	All SZGR 2.0 genes in this pathway
LINDSTEDT DENDRITIC CELL MATURATION B	53	36	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS KERATINOCYTE UP	91	63	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS FIBROBLAST UP	84	60	All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2	356	214	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
WORSCHECH TUMOR EVASION AND TOLEROGENICITY UP	30	19	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
TIAN TNF SIGNALING VIA NFKB	28	21	All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER UP	307	182	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38	337	236	All SZGR 2.0 genes in this pathway
ROESSLER LIVER CANCER METASTASIS UP	107	72	All SZGR 2.0 genes in this pathway
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF	222	159	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-30-3p	562	568	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	562	568	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-323	480	486	m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-9	29	35	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NFKB1