Summary ?
GeneID4808
SymbolNHLH2
SynonymsHEN2|NSCL2|bHLHa34
Descriptionnescient helix-loop-helix 2
ReferenceMIM:162361|HGNC:HGNC:7818|Ensembl:ENSG00000177551|HPRD:01213|Vega:OTTHUMG00000011969
Gene typeprotein-coding
Map location1p12-p11
Pascal p-value0.028
Fetal beta1.077
DMG1 (# studies)
eGeneAnterior cingulate cortex BA24
Cortex

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_IGenome scan meta-analysisPsr: 0.0235 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.00814 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg249995181116381079NHLH21.15E-9-0.0221.25E-6DMG:Jaffe_2016

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs120293491116372092NHLH2ENSG00000177551.51.787E-60.0214446gtex_brain_ba24
rs27972011116372190NHLH2ENSG00000177551.57.548E-70.0214348gtex_brain_ba24
rs120316811116372710NHLH2ENSG00000177551.51.794E-60.0213828gtex_brain_ba24
rs27971991116372907NHLH2ENSG00000177551.57.617E-70.0213631gtex_brain_ba24
rs18915101116373179NHLH2ENSG00000177551.51.807E-60.0213359gtex_brain_ba24
rs27971971116373295NHLH2ENSG00000177551.57.678E-70.0213243gtex_brain_ba24
rs109235721116374201NHLH2ENSG00000177551.51.806E-60.0212337gtex_brain_ba24
rs19705521116374340NHLH2ENSG00000177551.57.398E-70.0212198gtex_brain_ba24
rs18915091116374399NHLH2ENSG00000177551.57.172E-70.0212139gtex_brain_ba24
rs66703191116374729NHLH2ENSG00000177551.51.802E-60.0211809gtex_brain_ba24
rs66626191116374902NHLH2ENSG00000177551.51.802E-60.0211636gtex_brain_ba24
rs66627431116375007NHLH2ENSG00000177551.51.802E-60.0211531gtex_brain_ba24
rs67018731116375163NHLH2ENSG00000177551.51.802E-60.0211375gtex_brain_ba24
rs67018801116375189NHLH2ENSG00000177551.51.802E-60.0211349gtex_brain_ba24
rs66708901116375318NHLH2ENSG00000177551.51.802E-60.0211220gtex_brain_ba24
rs15731051116375415NHLH2ENSG00000177551.57.641E-70.0211123gtex_brain_ba24
rs2001135451116482634NHLH2ENSG00000177551.51.562E-60.02-96096gtex_brain_ba24

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
EHMT20.920.94
VPS16A0.920.92
RBM100.920.93
C7orf260.910.91
DAXX0.910.91
CXXC10.910.92
ATRIP0.910.90
USF10.910.89
ZBTB170.910.92
PRPF310.910.92
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.31-0.80-0.87
AF347015.27-0.79-0.87
MT-CO2-0.78-0.86
AF347015.33-0.76-0.84
AF347015.8-0.75-0.84
MT-CYB-0.74-0.83
AF347015.21-0.73-0.90
IFI27-0.73-0.83
COPZ2-0.72-0.78
AF347015.15-0.72-0.82

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0030528transcription regulator activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007417central nervous system developmentTASBrain (GO term level: 6)1328219 
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007617mating behaviorIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
GO:0042698ovulation cycleIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
ODONNELL TFRC TARGETS UP 456228All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP 14699All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP 293179All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN 164111All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514319All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP 380213All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390236All SZGR 2.0 genes in this pathway
KANNAN TP53 TARGETS UP 5840All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP 314201All SZGR 2.0 genes in this pathway
BACOLOD RESISTANCE TO ALKYLATING AGENTS DN 6045All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435318All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590403All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462273All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR UP 16697All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-128618624m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-130/30110141020m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-142-5p147114771Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-2169759821A,m8hsa-miR-216UAAUCUCAGCUGGCAACUGUG
miR-25/32/92/363/367148114871Ahsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-27136413701Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-30-5p9239301A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-33147914851Ahsa-miR-33GUGCAUUGUAGUUGCAUUG
hsa-miR-33bGUGCAUUGCUGUUGCAUUGCA
miR-342110211081Ahsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
miR-369-3p113011361Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37411301136m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-410147314791Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-4318528581Ahsa-miR-431UGUCUUGCAGGCCGUCAUGCA
miR-4884174241A,m8hsa-miR-488CCCAGAUAAUGGCACUCUCAA
miR-494134713541A,m8hsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-495969975m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-9142714331Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
miR-96900906m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC