Gene Page: NHLH2
Summary ?
| GeneID | 4808 |
| Symbol | NHLH2 |
| Synonyms | HEN2|NSCL2|bHLHa34 |
| Description | nescient helix-loop-helix 2 |
| Reference | MIM:162361|HGNC:HGNC:7818|Ensembl:ENSG00000177551|HPRD:01213|Vega:OTTHUMG00000011969 |
| Gene type | protein-coding |
| Map location | 1p12-p11 |
| Pascal p-value | 0.028 |
| Fetal beta | 1.077 |
| DMG | 1 (# studies) |
| eGene | Anterior cingulate cortex BA24 Cortex |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg24999518 | 1 | 116381079 | NHLH2 | 1.15E-9 | -0.022 | 1.25E-6 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs12029349 | 1 | 116372092 | NHLH2 | ENSG00000177551.5 | 1.787E-6 | 0.02 | 14446 | gtex_brain_ba24 |
| rs2797201 | 1 | 116372190 | NHLH2 | ENSG00000177551.5 | 7.548E-7 | 0.02 | 14348 | gtex_brain_ba24 |
| rs12031681 | 1 | 116372710 | NHLH2 | ENSG00000177551.5 | 1.794E-6 | 0.02 | 13828 | gtex_brain_ba24 |
| rs2797199 | 1 | 116372907 | NHLH2 | ENSG00000177551.5 | 7.617E-7 | 0.02 | 13631 | gtex_brain_ba24 |
| rs1891510 | 1 | 116373179 | NHLH2 | ENSG00000177551.5 | 1.807E-6 | 0.02 | 13359 | gtex_brain_ba24 |
| rs2797197 | 1 | 116373295 | NHLH2 | ENSG00000177551.5 | 7.678E-7 | 0.02 | 13243 | gtex_brain_ba24 |
| rs10923572 | 1 | 116374201 | NHLH2 | ENSG00000177551.5 | 1.806E-6 | 0.02 | 12337 | gtex_brain_ba24 |
| rs1970552 | 1 | 116374340 | NHLH2 | ENSG00000177551.5 | 7.398E-7 | 0.02 | 12198 | gtex_brain_ba24 |
| rs1891509 | 1 | 116374399 | NHLH2 | ENSG00000177551.5 | 7.172E-7 | 0.02 | 12139 | gtex_brain_ba24 |
| rs6670319 | 1 | 116374729 | NHLH2 | ENSG00000177551.5 | 1.802E-6 | 0.02 | 11809 | gtex_brain_ba24 |
| rs6662619 | 1 | 116374902 | NHLH2 | ENSG00000177551.5 | 1.802E-6 | 0.02 | 11636 | gtex_brain_ba24 |
| rs6662743 | 1 | 116375007 | NHLH2 | ENSG00000177551.5 | 1.802E-6 | 0.02 | 11531 | gtex_brain_ba24 |
| rs6701873 | 1 | 116375163 | NHLH2 | ENSG00000177551.5 | 1.802E-6 | 0.02 | 11375 | gtex_brain_ba24 |
| rs6701880 | 1 | 116375189 | NHLH2 | ENSG00000177551.5 | 1.802E-6 | 0.02 | 11349 | gtex_brain_ba24 |
| rs6670890 | 1 | 116375318 | NHLH2 | ENSG00000177551.5 | 1.802E-6 | 0.02 | 11220 | gtex_brain_ba24 |
| rs1573105 | 1 | 116375415 | NHLH2 | ENSG00000177551.5 | 7.641E-7 | 0.02 | 11123 | gtex_brain_ba24 |
| rs200113545 | 1 | 116482634 | NHLH2 | ENSG00000177551.5 | 1.562E-6 | 0.02 | -96096 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| EHMT2 | 0.92 | 0.94 |
| VPS16A | 0.92 | 0.92 |
| RBM10 | 0.92 | 0.93 |
| C7orf26 | 0.91 | 0.91 |
| DAXX | 0.91 | 0.91 |
| CXXC1 | 0.91 | 0.92 |
| ATRIP | 0.91 | 0.90 |
| USF1 | 0.91 | 0.89 |
| ZBTB17 | 0.91 | 0.92 |
| PRPF31 | 0.91 | 0.92 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.80 | -0.87 |
| AF347015.27 | -0.79 | -0.87 |
| MT-CO2 | -0.78 | -0.86 |
| AF347015.33 | -0.76 | -0.84 |
| AF347015.8 | -0.75 | -0.84 |
| MT-CYB | -0.74 | -0.83 |
| AF347015.21 | -0.73 | -0.90 |
| IFI27 | -0.73 | -0.83 |
| COPZ2 | -0.72 | -0.78 |
| AF347015.15 | -0.72 | -0.82 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IEA | - | |
| GO:0030528 | transcription regulator activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007417 | central nervous system development | TAS | Brain (GO term level: 6) | 1328219 |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0007617 | mating behavior | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0030154 | cell differentiation | IEA | - | |
| GO:0042698 | ovulation cycle | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
| LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS UP | 293 | 179 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
| HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
| KANNAN TP53 TARGETS UP | 58 | 40 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
| BACOLOD RESISTANCE TO ALKYLATING AGENTS DN | 60 | 45 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
| SMIRNOV RESPONSE TO IR 6HR UP | 166 | 97 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-128 | 618 | 624 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-130/301 | 1014 | 1020 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
| hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
| hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
| hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
| miR-142-5p | 1471 | 1477 | 1A | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-216 | 975 | 982 | 1A,m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
| miR-25/32/92/363/367 | 1481 | 1487 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-27 | 1364 | 1370 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-30-5p | 923 | 930 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-33 | 1479 | 1485 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
| miR-342 | 1102 | 1108 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
| miR-369-3p | 1130 | 1136 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-374 | 1130 | 1136 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-410 | 1473 | 1479 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-431 | 852 | 858 | 1A | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| miR-488 | 417 | 424 | 1A,m8 | hsa-miR-488 | CCCAGAUAAUGGCACUCUCAA |
| miR-494 | 1347 | 1354 | 1A,m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-495 | 969 | 975 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| miR-9 | 1427 | 1433 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
| miR-96 | 900 | 906 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.