Gene Page: NRL
Summary ?
| GeneID | 4901 |
| Symbol | NRL |
| Synonyms | D14S46E|NRL-MAF|RP27 |
| Description | neural retina leucine zipper |
| Reference | MIM:162080|HGNC:HGNC:8002|Ensembl:ENSG00000129535|HPRD:08875|Vega:OTTHUMG00000028789 |
| Gene type | protein-coding |
| Map location | 14q11.1-q11.2 |
| Pascal p-value | 0.242 |
| Fetal beta | -0.347 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.047 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | IEA | - | |
| GO:0003704 | specific RNA polymerase II transcription factor activity | TAS | 8939891 | |
| GO:0043565 | sequence-specific DNA binding | IEA | - | |
| GO:0046983 | protein dimerization activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0007601 | visual perception | TAS | 1729696 | |
| GO:0050896 | response to stimulus | IEA | - | |
| GO:0045872 | positive regulation of rhodopsin gene expression | IEA | - | |
| GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
| GO:0046548 | retinal rod cell development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | TAS | 8939891 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 ICP WITH H3K27ME3 | 74 | 46 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF ICP WITH H3K27ME3 | 206 | 108 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-338 | 175 | 181 | m8 | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
| miR-542-3p | 660 | 666 | m8 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.