Gene Page: ACO2
Summary ?
| GeneID | 50 |
| Symbol | ACO2 |
| Synonyms | ACONM|HEL-S-284|ICRD|OCA8|OPA9 |
| Description | aconitase 2 |
| Reference | MIM:100850|HGNC:HGNC:118|Ensembl:ENSG00000100412|HPRD:00012|Vega:OTTHUMG00000030544 |
| Gene type | protein-coding |
| Map location | 22q13.2 |
| Pascal p-value | 0.018 |
| Sherlock p-value | 0.644 |
| Support | G2Cdb.human_mitochondria G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ATP6AP1 | 0.91 | 0.91 |
| SEZ6L2 | 0.89 | 0.91 |
| CHPF | 0.87 | 0.90 |
| LENG4 | 0.87 | 0.88 |
| FAM127A | 0.86 | 0.87 |
| PCYOX1L | 0.86 | 0.85 |
| GRINA | 0.86 | 0.85 |
| PNPLA6 | 0.86 | 0.84 |
| CLSTN3 | 0.85 | 0.88 |
| PTPRN2 | 0.85 | 0.86 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.60 | -0.46 |
| AF347015.18 | -0.55 | -0.46 |
| MT-CO2 | -0.55 | -0.43 |
| AC098691.2 | -0.54 | -0.49 |
| NOSTRIN | -0.53 | -0.42 |
| AF347015.8 | -0.53 | -0.43 |
| AF347015.2 | -0.53 | -0.40 |
| AF347015.31 | -0.52 | -0.42 |
| AF347015.33 | -0.52 | -0.41 |
| AP002478.3 | -0.52 | -0.45 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003994 | aconitate hydratase activity | EXP | 1946331 | |
| GO:0003994 | aconitate hydratase activity | IEA | - | |
| GO:0005506 | iron ion binding | IDA | 9630632 | |
| GO:0016829 | lyase activity | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| GO:0051539 | 4 iron, 4 sulfur cluster binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006101 | citrate metabolic process | IDA | 9630632 | |
| GO:0006099 | tricarboxylic acid cycle | IDA | 9630632 | |
| GO:0006091 | generation of precursor metabolites and energy | TAS | 9630632 | |
| GO:0008152 | metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IDA | 18029348 | |
| GO:0005739 | mitochondrion | TAS | 9630632 | |
| GO:0005759 | mitochondrial matrix | EXP | 1946331 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CITRATE CYCLE TCA CYCLE | 32 | 23 | All SZGR 2.0 genes in this pathway |
| KEGG GLYOXYLATE AND DICARBOXYLATE METABOLISM | 16 | 12 | All SZGR 2.0 genes in this pathway |
| BIOCARTA KREB PATHWAY | 8 | 8 | All SZGR 2.0 genes in this pathway |
| REACTOME PYRUVATE METABOLISM AND CITRIC ACID TCA CYCLE | 48 | 32 | All SZGR 2.0 genes in this pathway |
| REACTOME TCA CYCLE AND RESPIRATORY ELECTRON TRANSPORT | 141 | 85 | All SZGR 2.0 genes in this pathway |
| REACTOME MITOCHONDRIAL PROTEIN IMPORT | 58 | 24 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF PROTEINS | 518 | 242 | All SZGR 2.0 genes in this pathway |
| REACTOME CITRIC ACID CYCLE TCA CYCLE | 26 | 16 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 MUTATED SIGNATURE 2 UP | 139 | 83 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 4 5WK DN | 196 | 131 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC TARGETS WITH EBOX | 230 | 156 | All SZGR 2.0 genes in this pathway |
| FERNANDEZ BOUND BY MYC | 182 | 116 | All SZGR 2.0 genes in this pathway |
| FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP | 151 | 100 | All SZGR 2.0 genes in this pathway |
| FLECHNER PBL KIDNEY TRANSPLANT REJECTED VS OK DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA SUBGROUPS | 30 | 20 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| SESTO RESPONSE TO UV C6 | 39 | 27 | All SZGR 2.0 genes in this pathway |
| JIANG AGING HYPOTHALAMUS DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 5 | 126 | 78 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV NHEK UP | 244 | 151 | All SZGR 2.0 genes in this pathway |
| JIANG AGING CEREBRAL CORTEX DN | 54 | 43 | All SZGR 2.0 genes in this pathway |
| LEIN LOCALIZED TO PROXIMAL DENDRITES | 37 | 26 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
| MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
| MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
| MOOTHA TCA | 16 | 13 | All SZGR 2.0 genes in this pathway |
| MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| DAZARD UV RESPONSE CLUSTER G5 | 12 | 8 | All SZGR 2.0 genes in this pathway |
| LU EZH2 TARGETS UP | 295 | 155 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-203.1 | 292 | 298 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.