Summary ?
GeneID5027
SymbolP2RX7
SynonymsP2X7
Descriptionpurinergic receptor P2X 7
ReferenceMIM:602566|HGNC:HGNC:8537|Ensembl:ENSG00000089041|HPRD:03977|Vega:OTTHUMG00000169153
Gene typeprotein-coding
Map location12q24
Pascal p-value0.209
Sherlock p-value0.286
Fetal beta-2.833
eGeneMyers' cis & trans
SupportGPCR SIGNALLING

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs16869851chr420690056P2RX750270.1trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005102receptor bindingISSNeurotransmitter (GO term level: 4)17785580 
GO:0001530lipopolysaccharide bindingISS-
GO:0001614purinergic nucleotide receptor activityIPI9038151 
GO:0004872receptor activityIEA-
GO:0004931ATP-gated cation channel activityIDA9038151 
GO:0004931ATP-gated cation channel activityIEA-
GO:0005524ATP bindingIEA-
GO:0005216ion channel activityIEA-
GO:0042803protein homodimerization activityNAS17895406 
GO:0046982protein heterodimerization activityISS17785580 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0002028regulation of sodium ion transportISS17785580 
GO:0010524positive regulation of calcium ion transport into cytosolIDA9038151 
GO:0007166cell surface receptor linked signal transductionISS-
GO:0006811ion transportIEA-
GO:0006812cation transportIEA-
GO:0042981regulation of apoptosisISS-
GO:0033198response to ATPIDA9038151 
GO:0030501positive regulation of bone mineralizationIEA-
GO:0030501positive regulation of bone mineralizationISS-
GO:0019233sensory perception of painISS-
GO:0032060bleb formationISS-
GO:0043409negative regulation of MAPKKK cascadeISS-
GO:0045779negative regulation of bone resorptionIEA-
GO:0045779negative regulation of bone resorptionISS-
GO:0045919positive regulation of cytolysisISS-
GO:0046931pore complex biogenesisIDA9038151 
GO:0050718positive regulation of interleukin-1 beta secretionIDA17036048 |18089587 
GO:0051495positive regulation of cytoskeleton organizationISS-
GO:0051709regulation of killing of cells of another organismNAS17785580 
GO:0051899membrane depolarizationIDA9038151 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmISS-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneISS17785580 
GO:0005887integral to plasma membraneIC9038151 
GO:0005887integral to plasma membraneIEA-
GO:0032059blebISS-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG CALCIUM SIGNALING PATHWAY 178134All SZGR 2.0 genes in this pathway
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION 272195All SZGR 2.0 genes in this pathway
REACTOME INNATE IMMUNE SYSTEM 279178All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM 933616All SZGR 2.0 genes in this pathway
REACTOME THE NLRP3 INFLAMMASOME 129All SZGR 2.0 genes in this pathway
REACTOME INFLAMMASOMES 1712All SZGR 2.0 genes in this pathway
REACTOME NUCLEOTIDE BINDING DOMAIN LEUCINE RICH REPEAT CONTAINING RECEPTOR NLR SIGNALING PATHWAYS 4633All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485293All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442892All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795478All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN 160110All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 DN 6545All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T4 9469All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718401All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3 445257All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177132All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387225All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP 194133All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745475All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN 418245All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-186765771m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU