Gene Page: PCSK6
Summary ?
GeneID | 5046 |
Symbol | PCSK6 |
Synonyms | PACE4|SPC4 |
Description | proprotein convertase subtilisin/kexin type 6 |
Reference | MIM:167405|HGNC:HGNC:8569|Ensembl:ENSG00000140479|HPRD:01329|Vega:OTTHUMG00000172097 |
Gene type | protein-coding |
Map location | 15q26.3 |
Pascal p-value | 0.028 |
Fetal beta | -1.464 |
eGene | Cerebellar Hemisphere |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizotypy,schizophrenias,schizotypal | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0008201 | heparin binding | IDA | 12535616 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008233 | peptidase activity | IEA | - | |
GO:0048406 | nerve growth factor binding | IDA | 8615794 | |
GO:0043499 | eukaryotic cell surface binding | IDA | 12535616 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0032902 | nerve growth factor production | IDA | neuron (GO term level: 11) | 8615794 |
GO:0009100 | glycoprotein metabolic process | IDA | 8218226 | |
GO:0006508 | proteolysis | IEA | - | |
GO:0007368 | determination of left/right symmetry | IEA | - | |
GO:0007354 | zygotic determination of anterior/posterior axis, embryo | IEA | - | |
GO:0051605 | protein maturation via proteolysis | IDA | 8218226 |9242664 |9738469 | |
GO:0030510 | regulation of BMP signaling pathway | TAS | 10467177 | |
GO:0032940 | secretion by cell | IDA | 8615794 | |
GO:0032455 | nerve growth factor processing | EXP | 12787574 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005796 | Golgi lumen | EXP | 8615794 | |
GO:0005576 | extracellular region | IEA | - | |
GO:0005615 | extracellular space | IDA | 8906861 | |
GO:0005622 | intracellular | IEA | - | |
GO:0005625 | soluble fraction | IDA | 8218226 | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0009986 | cell surface | IDA | 12535616 | |
GO:0031012 | extracellular matrix | IDA | 12535616 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NODAL | 18 | 11 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR MARKERS UP | 21 | 13 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER UP | 206 | 111 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
WILCOX RESPONSE TO PROGESTERONE UP | 152 | 90 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS A UP | 191 | 128 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 15Q26 AMPLICON | 22 | 19 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION G2 G3 UP | 28 | 14 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER METASTASIS UP | 56 | 31 | All SZGR 2.0 genes in this pathway |
HSIAO LIVER SPECIFIC GENES | 244 | 154 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
LEIN MEDULLA MARKERS | 81 | 48 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN LIVER DN | 10 | 9 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B UP | 172 | 109 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
IZADPANAH STEM CELL ADIPOSE VS BONE DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL UP | 185 | 112 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G3 DN | 51 | 32 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS UNANNOTATED UP | 85 | 50 | All SZGR 2.0 genes in this pathway |
FONTAINE FOLLICULAR THYROID ADENOMA DN | 68 | 45 | All SZGR 2.0 genes in this pathway |
FONTAINE THYROID TUMOR UNCERTAIN MALIGNANCY DN | 26 | 14 | All SZGR 2.0 genes in this pathway |
FONTAINE PAPILLARY THYROID CARCINOMA DN | 80 | 53 | All SZGR 2.0 genes in this pathway |
DEMAGALHAES AGING UP | 55 | 39 | All SZGR 2.0 genes in this pathway |
NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 1135 | 1142 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 1135 | 1141 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-21 | 1019 | 1026 | 1A,m8 | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
miR-543 | 1288 | 1294 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
miR-544 | 327 | 333 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
miR-9 | 321 | 327 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.