SZGR2

Summary ?

GeneID	50618
Symbol	ITSN2
Synonyms	PRO2015\|SH3D1B\|SH3P18\|SWA\|SWAP
Description	intersectin 2
Reference	MIM:604464\|HGNC:HGNC:6184\|Ensembl:ENSG00000198399\|HPRD:09193\|Vega:OTTHUMG00000090818
Gene type	protein-coding
Map location	2p23.3
Pascal p-value	0.098
Fetal beta	-0.627

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.2362

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005089	Rho guanyl-nucleotide exchange factor activity	IEA		-
GO:0005070	SH3/SH2 adaptor activity	TAS		9630982
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IPI		15231747
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006897	endocytosis	IEA		-
GO:0035023	regulation of Rho protein signal transduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID CDC42 REG PATHWAY	30	22	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN	180	101	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN	137	97	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP	197	135	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS	205	145	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 1	51	33	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN	203	134	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR DN	41	30	All SZGR 2.0 genes in this pathway
WANG TARGETS OF MLL CBP FUSION UP	44	26	All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS	191	131	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
ZHAN EARLY DIFFERENTIATION GENES DN	42	29	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	371	377	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-124/506	207	213	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	207	213	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	594	600	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	594	600	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-144	592	598	m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-148/152	486	493	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-153	162	169	1A,m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-200bc/429	282	288	1A	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-27	594	601	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	594	601	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-320	704	710	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-421	296	303	1A,m8	hsa-miR-421	GGCCUCAUUAAAUGUUUGUUG
miR-448	163	169	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-452	165	172	1A,m8	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC
miR-493-5p	722	728	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ITSN2