Gene Page: PAX3
Summary ?
GeneID | 5077 |
Symbol | PAX3 |
Synonyms | CDHS|HUP2|WS1|WS3 |
Description | paired box 3 |
Reference | MIM:606597|HGNC:HGNC:8617|Ensembl:ENSG00000135903|HPRD:09421|Vega:OTTHUMG00000133157 |
Gene type | protein-coding |
Map location | 2q35 |
Pascal p-value | 0.238 |
Fetal beta | -0.298 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02347074 | 2 | 223155925 | PAX3 | 2.784E-4 | -0.313 | 0.039 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0003700 | transcription factor activity | TAS | 9500554 | |
GO:0005515 | protein binding | IPI | 11029584 | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006366 | transcription from RNA polymerase II promoter | TAS | 9500554 | |
GO:0009887 | organ morphogenesis | TAS | 8447316 | |
GO:0007605 | sensory perception of sound | TAS | 9500554 | |
GO:0006915 | apoptosis | TAS | 10871843 | |
GO:0007275 | multicellular organismal development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BIOCARTA PML PATHWAY | 17 | 12 | All SZGR 2.0 genes in this pathway |
PID RB 1PATHWAY | 65 | 46 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
MYLLYKANGAS AMPLIFICATION HOT SPOT 25 | 15 | 6 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS DN | 135 | 88 | All SZGR 2.0 genes in this pathway |
TSENG ADIPOGENIC POTENTIAL DN | 46 | 28 | All SZGR 2.0 genes in this pathway |
SHARMA PILOCYTIC ASTROCYTOMA LOCATION DN | 7 | 5 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
ICHIBA GRAFT VERSUS HOST DISEASE 35D DN | 49 | 34 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
DANG MYC TARGETS UP | 143 | 100 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 612 | 618 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-1/206 | 91 | 98 | 1A,m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA | ||||
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-144 | 604 | 610 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-145 | 298 | 304 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-199 | 296 | 303 | 1A,m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-217 | 1239 | 1245 | 1A | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-25/32/92/363/367 | 599 | 606 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-30-5p | 928 | 934 | 1A | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG | ||||
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-380-5p | 1194 | 1200 | 1A | hsa-miR-380-5p | UGGUUGACCAUAGAACAUGCGC |
hsa-miR-563 | AGGUUGACAUACGUUUCCC | ||||
miR-409-3p | 90 | 96 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-485-5p | 1189 | 1196 | 1A,m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
miR-496 | 1228 | 1235 | 1A,m8 | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.