Gene Page: PBX2
Summary ?
GeneID | 5089 |
Symbol | PBX2 |
Synonyms | G17|HOX12|PBX2MHC |
Description | pre-B-cell leukemia homeobox 2 |
Reference | MIM:176311|HGNC:HGNC:8633|Ensembl:ENSG00000204304|HPRD:08890|Vega:OTTHUMG00000031116 |
Gene type | protein-coding |
Map location | 6p21.3 |
Pascal p-value | 1E-12 |
eGene | Myers' cis & trans Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2277116 | chr6 | 46966021 | PBX2 | 5089 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
HRH3 | 0.86 | 0.68 |
KCTD17 | 0.85 | 0.62 |
BSPRY | 0.83 | 0.70 |
C1orf127 | 0.81 | 0.48 |
NPL | 0.79 | 0.61 |
IKBKE | 0.79 | 0.51 |
INPP5A | 0.78 | 0.42 |
NEXN | 0.78 | 0.46 |
TTC39A | 0.76 | 0.77 |
RGS16 | 0.75 | 0.35 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MEIS3P2 | -0.28 | 0.09 |
EMX1 | -0.25 | -0.32 |
WDR86 | -0.24 | -0.36 |
PLEKHO1 | -0.24 | -0.32 |
FAM129B | -0.24 | -0.57 |
EMID1 | -0.24 | -0.37 |
ZNF184 | -0.24 | -0.14 |
MPPED1 | -0.23 | -0.34 |
TMEM74 | -0.23 | -0.30 |
DPP4 | -0.23 | -0.30 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0005515 | protein binding | IPI | 14667819 | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS DN | 186 | 114 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 DN | 242 | 165 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION | 77 | 51 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION CCNE1 | 40 | 26 | All SZGR 2.0 genes in this pathway |
PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
ROPERO HDAC2 TARGETS | 114 | 71 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
HOFMANN CELL LYMPHOMA UP | 50 | 35 | All SZGR 2.0 genes in this pathway |
ALCALAY AML BY NPM1 LOCALIZATION DN | 184 | 132 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
RAMASWAMY METASTASIS DN | 61 | 47 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 10HR UP | 101 | 69 | All SZGR 2.0 genes in this pathway |
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN | 161 | 105 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D CLUSTER DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D DN | 78 | 34 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 36HR | 152 | 88 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
GHANDHI DIRECT IRRADIATION DN | 33 | 23 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 544 | 550 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU | ||||
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-182 | 457 | 463 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA | ||||
miR-185 | 1565 | 1571 | m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
miR-218 | 91 | 98 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-299-5p | 565 | 571 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
miR-96 | 457 | 463 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.