Summary ?
GeneID51126
SymbolNAA20
SynonymsNAT3|NAT3P|NAT5|NAT5P|dJ1002M8.1
DescriptionN(alpha)-acetyltransferase 20, NatB catalytic subunit
ReferenceMIM:610833|HGNC:HGNC:15908|Ensembl:ENSG00000173418|HPRD:07136|Vega:OTTHUMG00000031998
Gene typeprotein-coding
Map location20p11.23
Pascal p-value0.333
Fetal beta-1.052
DMG1 (# studies)

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg086994352019997606NAA202.77E-8-0.0138.7E-6DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016740transferase activityIEA-
GO:0008415acyltransferase activityIEA-
GO:0008080N-acetyltransferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008152metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIDA11256614 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
WANG LMO4 TARGETS DN 352225All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER UP 227137All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024594All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893528All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP 266171All SZGR 2.0 genes in this pathway
NOUZOVA TRETINOIN AND H4 ACETYLATION 14385All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911527All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011592All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366257All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882538All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/1073343401Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-222202271A,m8hsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
miR-3203803861Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA