Gene Page: FAM13B
Summary ?
| GeneID | 51306 |
| Symbol | FAM13B |
| Synonyms | ARHGAP49|C5orf5|FAM13B1|KHCHP|N61 |
| Description | family with sequence similarity 13 member B |
| Reference | MIM:609371|HGNC:HGNC:1335|Ensembl:ENSG00000031003|HPRD:06464|Vega:OTTHUMG00000129202 |
| Gene type | protein-coding |
| Map location | 5q31 |
| Pascal p-value | 0.006 |
| Sherlock p-value | 0.054 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005096 | GTPase activator activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007165 | signal transduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
| UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
| WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
| MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
| SHEPARD CRUSH AND BURN MUTANT DN | 185 | 111 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
| CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-129-5p | 1860 | 1866 | m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-130/301 | 1875 | 1881 | 1A | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
| hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
| hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
| hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
| miR-148/152 | 1816 | 1822 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
| hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
| hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
| miR-181 | 1834 | 1840 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-23 | 825 | 831 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-25/32/92/363/367 | 1549 | 1555 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-29 | 865 | 871 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-30-3p | 429 | 436 | 1A,m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
| hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
| miR-323 | 824 | 831 | 1A,m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
| miR-342 | 827 | 833 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
| miR-34b | 718 | 724 | 1A | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
| miR-450 | 1860 | 1866 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
| miR-543 | 1835 | 1841 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.