Gene Page: FAM53C
Summary ?
| GeneID | 51307 |
| Symbol | FAM53C |
| Synonyms | C5orf6 |
| Description | family with sequence similarity 53 member C |
| Reference | MIM:609372|HGNC:HGNC:1336|Ensembl:ENSG00000120709|HPRD:10785|Vega:OTTHUMG00000129201 |
| Gene type | protein-coding |
| Map location | 5q31 |
| Pascal p-value | 0.001 |
| Sherlock p-value | 0.621 |
| Fetal beta | -0.297 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg00197381 | 5 | 137673669 | FAM53C | -0.022 | 0.25 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| JIANG VHL TARGETS | 138 | 91 | All SZGR 2.0 genes in this pathway |
| MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
| MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
| CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-125/351 | 118 | 124 | m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-182 | 2591 | 2597 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-214 | 2289 | 2295 | 1A | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
| hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG | ||||
| miR-22 | 2560 | 2566 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
| miR-326 | 2395 | 2401 | m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
| hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG | ||||
| miR-342 | 247 | 253 | m8 | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
| miR-485-5p | 386 | 392 | m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
| miR-7 | 1174 | 1181 | 1A,m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
| miR-96 | 2591 | 2597 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.