SZGR2

Summary ?

GeneID	5142
Symbol	PDE4B
Synonyms	DPDE4\|PDEIVB
Description	phosphodiesterase 4B
Reference	MIM:600127\|HGNC:HGNC:8781\|Ensembl:ENSG00000184588\|HPRD:02528\|Vega:OTTHUMG00000009088
Gene type	protein-coding
Map location	1p31
Pascal p-value	1.456E-4
Fetal beta	-0.401
eGene	Hypothalamus Myers' cis & trans
Support	G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.02692
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1444

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1218887	chr13	28097566	PDE4B	5142		0.19		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SYT9	0.57	0.47
TANC1	0.56	0.46
NTNG1	0.56	0.33
B3GALTL	0.55	0.42
NKD1	0.55	0.38
STEAP3	0.54	0.43
RGS3	0.54	0.31
SLC17A6	0.53	0.22
TTC39A	0.53	0.35
PLA2R1	0.53	0.44

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SLC26A4	-0.27	-0.26
IER5L	-0.25	-0.23
EMX1	-0.25	-0.24
ID2	-0.25	-0.27
GPR22	-0.24	-0.20
RPL41	-0.22	-0.30
SIGIRR	-0.22	-0.26
BCL11A	-0.22	-0.17
NRL	-0.21	-0.19
TTC9B	-0.21	-0.20

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004115	3',5'-cyclic-AMP phosphodiesterase activity	TAS		9371714
GO:0016787	hydrolase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007165	signal transduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IDA		18029348
GO:0005625	soluble fraction	TAS		9371714
GO:0005626	insoluble fraction	TAS		9371714
GO:0005737	cytoplasm	IDA		18029348

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG PURINE METABOLISM	159	96	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME OPIOID SIGNALLING	78	56	All SZGR 2.0 genes in this pathway
REACTOME DARPP 32 EVENTS	25	20	All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING	805	368	All SZGR 2.0 genes in this pathway
REACTOME G ALPHA S SIGNALLING EVENTS	121	82	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR MARKERS UP	21	13	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 DN	267	178	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN	320	184	All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN DN	241	146	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP	233	161	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN	162	116	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP	185	126	All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP	456	228	All SZGR 2.0 genes in this pathway
ODONNELL TARGETS OF MYC AND TFRC UP	83	50	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A DN	90	61	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 2	127	92	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER UP	227	137	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN 2FC DN	21	13	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
SHIPP DLBCL CURED VS FATAL DN	45	30	All SZGR 2.0 genes in this pathway
STOSSI RESPONSE TO ESTRADIOL	50	35	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED DN	246	180	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
CHEN LVAD SUPPORT OF FAILING HEART DN	42	32	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
MCCLUNG COCAINE REWARD 5D	79	62	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS DN	57	42	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR DN	101	70	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL	254	164	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS	108	71	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D2	41	30	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 3HR	74	47	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP	196	137	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR DN	191	123	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP	294	199	All SZGR 2.0 genes in this pathway
TOOKER GEMCITABINE RESISTANCE UP	79	40	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
VALK AML WITH FLT3 ITD	40	22	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3	445	257	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway
STAMBOLSKY RESPONSE TO VITAMIN D3 UP	84	48	All SZGR 2.0 genes in this pathway
HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP	242	159	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR UP	166	97	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	903	909	m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	903	909	m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-124/506	398	404	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	398	404	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-142-3p	1432	1439	1A,m8	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-23	1608	1615	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
				hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
				hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-323	1608	1614	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
				hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
				hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-34b	1067	1073	1A	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-361	1622	1629	1A,m8	hsa-miR-361^brain	UUAUCAGAAUCUCCAGGGGUAC
miR-369-3p	1110	1117	1A,m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	1111	1117	m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-374	1111	1117	m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-409-3p	23	29	m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU
miR-410	1014	1020	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
				hsa-miR-410	AAUAUAACACAGAUGGCCUGU
				hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-505	438	444	1A	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC
miR-539	1799	1805	1A	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PDE4B