SZGR2

Summary ?

GeneID	51440
Symbol	HPCAL4
Synonyms	HLP4
Description	hippocalcin like 4
Reference	HGNC:HGNC:18212\|Ensembl:ENSG00000116983\|HPRD:17113\|Vega:OTTHUMG00000009246
Gene type	protein-coding
Map location	1p34.2
Pascal p-value	0.197
Sherlock p-value	0.622
Fetal beta	-2.453
DMG	1 (# studies)
eGene	Caudate basal ganglia
Support	INTRACELLULAR SIGNAL TRANSDUCTION

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg22827640	1	40157125	HPCAL4	1.98E-8	-0.01	6.9E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005509	calcium ion binding	TAS		10520747
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007417	central nervous system development	TAS	Brain (GO term level: 6)	10520747
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IDA		11256614

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
KIM MYCL1 AMPLIFICATION TARGETS UP	13	11	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
LEIN LOCALIZED TO DISTAL AND PROXIMAL DENDRITES	17	12	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL	129	85	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-151	1557	1563	m8	hsa-miR-151^brain	ACUAGACUGAAGCUCCUUGAGG
miR-22	2502	2508	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-29	530	537	1A,m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-335	1535	1541	1A	hsa-miR-335^brain	UCAAGAGCAAUAACGAAAAAUGU
miR-7	2435	2442	1A,m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HPCAL4