SZGR2

Summary ?

GeneID	51552
Symbol	RAB14
Synonyms	FBP\|RAB-14
Description	RAB14, member RAS oncogene family
Reference	MIM:612673\|HGNC:HGNC:16524\|Ensembl:ENSG00000119396\|HPRD:06693\|Vega:OTTHUMG00000020582
Gene type	protein-coding
Map location	9q33.2
Pascal p-value	0.01
Support	INTRACELLULAR TRAFFICKING

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003924	GTPase activity	NAS		15004230
GO:0005515	protein binding	IPI		17353931
GO:0005525	GTP binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007269	neurotransmitter secretion	NAS	neuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8)	-
GO:0007264	small GTPase mediated signal transduction	NAS		-
GO:0006895	Golgi to endosome transport	TAS		15004230
GO:0016192	vesicle-mediated transport	NAS		15004230
GO:0015031	protein transport	IEA		-
GO:0046907	intracellular transport	NAS		15004230
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005791	rough endoplasmic reticulum	ISS		-
GO:0005795	Golgi stack	ISS		-
GO:0005829	cytosol	ISS		-
GO:0005622	intracellular	IDA		11256614
GO:0005624	membrane fraction	ISS		-
GO:0005764	lysosome	ISS		-
GO:0005769	early endosome	ISS		-
GO:0005770	late endosome	ISS		-
GO:0005886	plasma membrane	ISS		-
GO:0048471	perinuclear region of cytoplasm	ISS		-
GO:0042175	nuclear envelope-endoplasmic reticulum network	ISS		-
GO:0030140	trans-Golgi network transport vesicle	ISS		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN	352	225	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP	164	122	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 UP	121	71	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2A DN	141	84	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q	116	71	All SZGR 2.0 genes in this pathway
PETRETTO HEART MASS QTL CIS UP	28	15	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
CHEN LUNG CANCER SURVIVAL	28	22	All SZGR 2.0 genes in this pathway
IIZUKA LIVER CANCER PROGRESSION L1 G1 UP	25	15	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN	245	154	All SZGR 2.0 genes in this pathway
XU CREBBP TARGETS DN	44	31	All SZGR 2.0 genes in this pathway
JIANG VHL TARGETS	138	91	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D6	37	25	All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX UP	89	59	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS DN	135	88	All SZGR 2.0 genes in this pathway
JIANG AGING CEREBRAL CORTEX DN	54	43	All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE BPA E2	118	65	All SZGR 2.0 genes in this pathway
FLOTHO PEDIATRIC ALL THERAPY RESPONSE UP	53	33	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2	86	50	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA VIA VHL	34	24	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS UP	91	59	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN UP	90	58	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	1052	1058	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-124.1	1047	1053	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1047	1053	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1047	1053	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-133	1842	1848	m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	1842	1848	m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-144	1052	1058	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-145	1673	1680	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-185	207	213	m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-188	1172	1178	m8	hsa-miR-188	CAUCCCUUGCAUGGUGGAGGGU
miR-19	1088	1094	1A	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	1088	1094	1A	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-204/211	1283	1290	1A,m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	1283	1290	1A,m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-205	663	669	1A	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-214	1852	1858	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-214	1852	1858	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-25/32/92/363/367	1950	1957	1A,m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-27	430	436	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	430	436	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-31	1044	1050	m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-320	597	603	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-338	294	301	1A,m8	hsa-miR-338^brain	UCCAGCAUCAGUGAUUUUGUUGA
miR-34b	65	71	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-381	1644	1650	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-490	177	183	1A	hsa-miR-490	CAACCUGGAGGACUCCAUGCUG
miR-500	1948	1955	1A,m8	hsa-miR-500	AUGCACCUGGGCAAGGAUUCUG
miR-544	1683	1690	1A,m8	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RAB14