Gene Page: LGSN
Summary ?
| GeneID | 51557 |
| Symbol | LGSN |
| Synonyms | GLULD1|LGS |
| Description | lengsin, lens protein with glutamine synthetase domain |
| Reference | MIM:611470|HGNC:HGNC:21016|Ensembl:ENSG00000146166|HPRD:13585| |
| Gene type | protein-coding |
| Map location | 6pter-q22.33 |
| Pascal p-value | 4.554E-4 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004356 | glutamate-ammonia ligase activity | IEA | glutamate (GO term level: 7) | - |
| GO:0003824 | catalytic activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006807 | nitrogen compound metabolic process | IEA | - | |
| GO:0006542 | glutamine biosynthetic process | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| JI METASTASIS REPRESSED BY STK11 | 27 | 17 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-153 | 222 | 228 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-448 | 221 | 228 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.