Gene Page: RAPGEF6
Summary ?
GeneID | 51735 |
Symbol | RAPGEF6 |
Synonyms | KIA001LB|PDZ-GEF2|PDZGEF2|RA-GEF-2|RAGEF2 |
Description | Rap guanine nucleotide exchange factor 6 |
Reference | MIM:610499|HGNC:HGNC:20655|Ensembl:ENSG00000158987|HPRD:11483|Vega:OTTHUMG00000162683 |
Gene type | protein-coding |
Map location | 5q31.1 |
Pascal p-value | 0.056 |
Sherlock p-value | 0.461 |
Fetal beta | 0.939 |
DMG | 2 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 4 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 4 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
Expression | Meta-analysis of gene expression | P value: 1.556 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg19900557 | 5 | 130915806 | RAPGEF6 | 2.63E-4 | 0.255 | 0.038 | DMG:Wockner_2014 |
cg05052335 | 5 | 130970657 | RAPGEF6 | 9.73E-11 | -0.019 | 4.49E-7 | DMG:Jaffe_2016 |
cg26400169 | 5 | 131131892 | RAPGEF6 | 5.34E-8 | -0.008 | 1.39E-5 | DMG:Jaffe_2016 |
cg21160151 | 5 | 131131930 | RAPGEF6 | 7.09E-8 | -0.009 | 1.71E-5 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16829545 | chr2 | 151977407 | RAPGEF6 | 51735 | 0 | trans | ||
rs336544 | chr3 | 161060557 | RAPGEF6 | 51735 | 0.07 | trans | ||
rs16955618 | chr15 | 29937543 | RAPGEF6 | 51735 | 7.926E-4 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005085 | guanyl-nucleotide exchange factor activity | IDA | 11524421 | |
GO:0005085 | guanyl-nucleotide exchange factor activity | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0017016 | Ras GTPase binding | IDA | 11524421 | |
GO:0030742 | GTP-dependent protein binding | IDA | 11524421 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007265 | Ras protein signal transduction | NAS | 11524421 | |
GO:0007165 | signal transduction | IEA | - | |
GO:0051056 | regulation of small GTPase mediated signal transduction | IEA | - | |
GO:0043087 | regulation of GTPase activity | NAS | 11524421 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005886 | plasma membrane | IDA | 11524421 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN | 136 | 86 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES SKIN UP | 177 | 113 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
TERAMOTO OPN TARGETS CLUSTER 7 | 19 | 16 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN THYMUS UP | 196 | 137 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN | 37 | 29 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D UP | 89 | 62 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-133 | 256 | 262 | m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-135 | 362 | 369 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-362 | 409 | 416 | 1A,m8 | hsa-miR-362 | AAUCCUUGGAACCUAGGUGUGAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.