Gene Page: PLCD1
Summary ?
| GeneID | 5333 |
| Symbol | PLCD1 |
| Synonyms | NDNC3|PLC-III |
| Description | phospholipase C delta 1 |
| Reference | MIM:602142|HGNC:HGNC:9060|Ensembl:ENSG00000187091|HPRD:09073|Vega:OTTHUMG00000130813 |
| Gene type | protein-coding |
| Map location | 3p22-p21.3 |
| Pascal p-value | 0.389 |
| Sherlock p-value | 0.187 |
| Fetal beta | -0.683 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg23971255 | 3 | 38071301 | PLCD1 | 1.85E-4 | -0.262 | 0.034 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs11080561 | chr18 | 12257229 | PLCD1 | 5333 | 0.01 | trans | ||
| rs10126993 | chrX | 35885796 | PLCD1 | 5333 | 0 | trans | ||
| rs6527524 | 0 | PLCD1 | 5333 | 0 | trans | |||
| rs4501739 | chrX | 35960848 | PLCD1 | 5333 | 8.183E-5 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PCTK3 | 0.94 | 0.92 |
| ATPGD1 | 0.93 | 0.92 |
| SHROOM1 | 0.92 | 0.93 |
| SEMA3B | 0.92 | 0.89 |
| TMEM63A | 0.91 | 0.94 |
| ABCA2 | 0.90 | 0.74 |
| TMC6 | 0.90 | 0.89 |
| UAP1L1 | 0.90 | 0.93 |
| C11orf9 | 0.90 | 0.91 |
| CD22 | 0.90 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| POLB | -0.55 | -0.79 |
| MED19 | -0.54 | -0.74 |
| FRG1 | -0.53 | -0.75 |
| STMN1 | -0.53 | -0.73 |
| ALKBH2 | -0.52 | -0.76 |
| IFT52 | -0.52 | -0.74 |
| TRNAU1AP | -0.52 | -0.72 |
| NR2C2AP | -0.52 | -0.75 |
| ING4 | -0.51 | -0.72 |
| RARS2 | -0.51 | -0.70 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004871 | signal transducer activity | IEA | - | |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0004435 | phosphoinositide phospholipase C activity | IEA | - | |
| GO:0004435 | phosphoinositide phospholipase C activity | TAS | 9588182 | |
| GO:0016787 | hydrolase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001525 | angiogenesis | IEA | - | |
| GO:0001890 | placenta development | IEA | - | |
| GO:0016042 | lipid catabolic process | IEA | - | |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| GO:0006644 | phospholipid metabolic process | TAS | 9588182 | |
| GO:0006629 | lipid metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005829 | cytosol | IEA | - | |
| GO:0005737 | cytoplasm | IDA | 15702972 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG INOSITOL PHOSPHATE METABOLISM | 54 | 42 | All SZGR 2.0 genes in this pathway |
| KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
| KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM | 76 | 56 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS UP | 293 | 179 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
| PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 AND TP63 TARGETS | 205 | 145 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| GOLDRATH IMMUNE MEMORY | 65 | 42 | All SZGR 2.0 genes in this pathway |
| URS ADIPOCYTE DIFFERENTIATION UP | 74 | 51 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
| JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
| SESTO RESPONSE TO UV C7 | 68 | 44 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS UP | 108 | 78 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-191 | 193 | 200 | 1A,m8 | hsa-miR-191brain | CAACGGAAUCCCAAAAGCAGCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.