Summary ?
GeneID54487
SymbolDGCR8
SynonymsC22orf12|DGCRK6|Gy1|pasha
DescriptionDGCR8 microprocessor complex subunit
ReferenceMIM:609030|HGNC:HGNC:2847|Ensembl:ENSG00000128191|HPRD:09913|Vega:OTTHUMG00000150503
Gene typeprotein-coding
Map location22q11.2
Pascal p-value7.356E-4
Sherlock p-value0.544
Fetal beta0.838
eGeneMyers' cis & trans
Meta
SupportAscano FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CNV:YESCopy number variation studiesManual curation
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IGenome scan meta-analysisPsr: 0.031 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs17392743chr154764240DGCR8544870.01trans
rs16829545chr2151977407DGCR8544871.056E-6trans
rs3845734chr2171125572DGCR8544870.09trans
rs7584986chr2184111432DGCR8544873.289E-4trans
rs16955618chr1529937543DGCR8544871.257E-13trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003725double-stranded RNA bindingIEA-
GO:0005515protein bindingIPI15574589 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0031053primary microRNA processingIDA15531877 |15574589 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIDA15574589 
GO:0005737cytoplasmIDA11256614 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PID P53 DOWNSTREAM PATHWAY 13794All SZGR 2.0 genes in this pathway
REACTOME MICRORNA MIRNA BIOGENESIS 239All SZGR 2.0 genes in this pathway
REACTOME REGULATORY RNA PATHWAYS 2612All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN 352225All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 17811082All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770415All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514319All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED 728415All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658397All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-205314320m8hsa-miR-205UCCUUCAUUCCACCGGAGUCUG
miR-2087207261Ahsa-miR-208AUAAGACGAGCAAAAAGCUUGU
miR-4997197261A,m8hsa-miR-499UUAAGACUUGCAGUGAUGUUUAA