SZGR2

Summary ?

GeneID	5454
Symbol	POU3F2
Synonyms	BRN2\|N-Oct3\|OCT7\|OTF-7\|OTF7\|POUF3\|brn-2\|oct-7
Description	POU class 3 homeobox 2
Reference	MIM:600494\|HGNC:HGNC:9215\|Ensembl:ENSG00000184486\|HPRD:02734\|Vega:OTTHUMG00000015258
Gene type	protein-coding
Map location	6q16
Pascal p-value	0.152
Fetal beta	2.058
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg04283429	6	99280108	POU3F2	7.81E-9	-0.03	3.77E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs920513	chr1	120272605	POU3F2	5454	0.15	trans
rs10915848	chr1	225788919	POU3F2	5454	0.03	trans
rs6544404	chr2	41502544	POU3F2	5454	0.14	trans
rs1155107	chr3	26843376	POU3F2	5454	0	trans
rs9848111	chr3	26847784	POU3F2	5454	0.2	trans
rs1395163	chr3	31028951	POU3F2	5454	0.08	trans
rs17029291	chr3	32402138	POU3F2	5454	1.095E-6	trans
rs2197208	chr3	105465403	POU3F2	5454	0.2	trans
rs1553189	chr3	112939422	POU3F2	5454	0	trans
rs1807299	chr3	134470799	POU3F2	5454	0.04	trans
rs6771817	chr3	165557099	POU3F2	5454	0.1	trans
rs830202	chr3	165654796	POU3F2	5454	0.01	trans
rs4645225	chr4	126010830	POU3F2	5454	0.05	trans
rs750544	chr5	51749054	POU3F2	5454	8.811E-4	trans
rs17146240	chr5	119522933	POU3F2	5454	0.01	trans
rs17146261	chr5	119534252	POU3F2	5454	0.01	trans
rs17165234	chr5	126403634	POU3F2	5454	0.06	trans
rs2807510	chr6	73090536	POU3F2	5454	0.04	trans
rs4299797	chr6	86945707	POU3F2	5454	0.19	trans
rs9385758	chr6	136729593	POU3F2	5454	0.01	trans
rs4617108	chr7	49423831	POU3F2	5454	0.03	trans
rs3779536	chr7	127233976	POU3F2	5454	0	trans
rs4615570	chr8	13349013	POU3F2	5454	0.02	trans
rs1432030	chr8	133175445	POU3F2	5454	0.06	trans
rs17060365	chr9	77222282	POU3F2	5454	0.14	trans
rs7894597	chr10	9384581	POU3F2	5454	0.09	trans
rs11000486	chr10	74762547	POU3F2	5454	0.17	trans
rs12253630	chr10	74768923	POU3F2	5454	0.08	trans
rs7078127	chr10	74847633	POU3F2	5454	0.04	trans
rs12569493	chr10	74886042	POU3F2	5454	0	trans
rs16930362	chr10	74890320	POU3F2	5454	4.305E-4	trans
rs2271904	chr10	74894374	POU3F2	5454	0.04	trans
rs7092445	chr10	74921991	POU3F2	5454	0.01	trans
rs12256576	chr10	74934313	POU3F2	5454	0.1	trans
rs1867565	chr10	74977780	POU3F2	5454	0.11	trans
rs11000557	chr10	74987393	POU3F2	5454	0.06	trans
rs16915029	chr10	75001994	POU3F2	5454	0.01	trans
rs14488	chr10	75007274	POU3F2	5454	0.04	trans
rs16930466	chr10	75007587	POU3F2	5454	0.01	trans
rs11000579	chr10	75027961	POU3F2	5454	0.06	trans
rs2183902	chr10	75079279	POU3F2	5454	0.13	trans
rs11000607	chr10	75089777	POU3F2	5454	0	trans
rs6480700	chr10	75101689	POU3F2	5454	0.03	trans
rs16930573	chr10	75167645	POU3F2	5454	0	trans
rs12571454	chr10	75208954	POU3F2	5454	0	trans
rs17136959	chr11	78373036	POU3F2	5454	0.18	trans
rs4944213	chr11	78395188	POU3F2	5454	0.18	trans
rs17054422	chr13	37317864	POU3F2	5454	0.19	trans
rs1610001	chr13	100484419	POU3F2	5454	0.02	trans
rs1324669	chr13	107872446	POU3F2	5454	3.5E-8	trans
rs1950367	chr14	37657845	POU3F2	5454	0.2	trans
rs3742829	chr14	73489267	POU3F2	5454	0.03	trans
rs8055506	chr16	13661723	POU3F2	5454	0	trans
rs16962446	chr16	13694936	POU3F2	5454	0	trans
rs17199331	chr16	13747589	POU3F2	5454	0.03	trans
rs16958358	chr17	55502410	POU3F2	5454	4.672E-5	trans
rs16949125	chr18	45887469	POU3F2	5454	0.19	trans
rs1016438	chr19	57591037	POU3F2	5454	0.11	trans
rs16987990	chr20	41966000	POU3F2	5454	0.05	trans
rs6098023	chr20	53113740	POU3F2	5454	2.196E-4	trans
rs6015314	chr20	57167224	POU3F2	5454	0	trans
rs17145698	chrX	40218345	POU3F2	5454	0	trans
rs17328938	chrX	99519447	POU3F2	5454	0.05	trans
rs1335267	chrX	99570223	POU3F2	5454	0.05	trans
rs7065248	chrX	115510530	POU3F2	5454	0.04	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	TAS		7601453 \|9482665
GO:0042802	identical protein binding	IPI		11029584
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0014002	astrocyte development	IEA	neuron, astrocyte, Glial (GO term level: 10)	-
GO:0050770	regulation of axonogenesis	IEA	neuron, axon (GO term level: 13)	-
GO:0006357	regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0008284	positive regulation of cell proliferation	IDA		15024079
GO:0008544	epidermis development	IEA		-
GO:0021985	neurohypophysis development	IEA		-
GO:0021979	hypothalamus cell differentiation	IEA		-
GO:0040018	positive regulation of multicellular organism growth	IEA		-
GO:0045595	regulation of cell differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP	238	135	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION HBZ	41	27	All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER DN	54	37	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN	200	112	All SZGR 2.0 genes in this pathway
SHEPARD BMYB TARGETS	74	41	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
LEE AGING MUSCLE UP	45	33	All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE DN	61	39	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER LATE RECURRENCE DN	69	48	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	1646	1652	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	1646	1652	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-130/301	521	527	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-148/152	522	528	m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-15/16/195/424/497	430	436	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-19	520	526	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	520	526	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-199	172	179	1A,m8	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	172	179	1A,m8	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-204/211	1695	1702	1A,m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	1695	1702	1A,m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-218	1678	1684	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-224	1923	1930	1A,m8	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-27	1646	1652	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1646	1652	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-320	2404	2410	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-378	825	831	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-378	825	831	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-410	2528	2534	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-494	1890	1896	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-494	1890	1896	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-495	1517	1523	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-542-3p	1975	1981	1A	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA
miR-544	2256	2263	1A,m8	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU
miR-9	777	783	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: POU3F2