Gene Page: GEMIN8
Summary ?
| GeneID | 54960 |
| Symbol | GEMIN8 |
| Synonyms | FAM51A1 |
| Description | gem nuclear organelle associated protein 8 |
| Reference | MIM:300962|HGNC:HGNC:26044|HPRD:06533| |
| Gene type | protein-coding |
| Map location | Xp22.2 |
| DEG p-value | DEG:Zhao_2015:p=2.16e-05:q=0.0404 |
| Fetal beta | 0.045 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 17023415 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000387 | spliceosomal snRNP biogenesis | IDA | 16434402 | |
| GO:0006397 | mRNA processing | IEA | - | |
| GO:0008380 | RNA splicing | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0032797 | SMN complex | IDA | neuron (GO term level: 6) | 16434402 |
| GO:0005634 | nucleus | IDA | 16434402 | |
| GO:0005681 | spliceosome | IEA | - | |
| GO:0005737 | cytoplasm | IDA | 17023415 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER P6 | 91 | 44 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
| LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-182 | 192 | 198 | m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-34b | 301 | 307 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.