Summary ?
GeneID55079
SymbolFEZF2
SynonymsFEZ|FEZL|FKSG36|TOF|ZFP312|ZNF312
DescriptionFEZ family zinc finger 2
ReferenceMIM:607414|HGNC:HGNC:13506|Ensembl:ENSG00000153266|HPRD:07596|Vega:OTTHUMG00000158705
Gene typeprotein-coding
Map location3p14.2
Pascal p-value0.093
Sherlock p-value0.364
Fetal beta1.949

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 5 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007413axonal fasciculationIEAneuron, axon (GO term level: 13)-
GO:0007411axon guidanceIEAaxon (GO term level: 13)-
GO:0030900forebrain developmentIEABrain (GO term level: 8)-
GO:0016358dendrite developmentIEAneurite, dendrite (GO term level: 11)-
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0007626locomotory behaviorIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
LEE NEURAL CREST STEM CELL DN 11879All SZGR 2.0 genes in this pathway
KAN RESPONSE TO ARSENIC TRIOXIDE 12380All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER HCP WITH H3K27ME3 9772All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K27ME3 7959All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435318All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341243All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590403All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857456All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL 12985All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1381251311Ahsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-493-5p3553611Ahsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU