Summary ?
GeneID5514
SymbolPPP1R10
SynonymsCAT53|FB19|PNUTS|PP1R10|R111|p99
Descriptionprotein phosphatase 1 regulatory subunit 10
ReferenceMIM:603771|HGNC:HGNC:9284|Ensembl:ENSG00000204569|HPRD:04797|Vega:OTTHUMG00000031259
Gene typeprotein-coding
Map location6p21.3
Pascal p-value1.51E-14
Sherlock p-value0.706
Fetal beta0.435
DMG2 (# studies)
eGeneMeta
SupportAscano FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Nishioka_2013Genome-wide DNA methylation analysisThe authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 2
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GSMA_IGenome scan meta-analysisPsr: 0.033 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg19256656630579560PPP1R105.552E-40.5260.049DMG:Wockner_2014
cg04513728630584980PPP1R10-0.0340.38DMG:Nishioka_2013


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
C7orf260.960.97
RNPS10.960.95
SF3B20.950.95
DAXX0.950.95
RAB350.950.96
DGCR140.950.95
LSM14B0.950.96
BYSL0.950.95
ISG20L20.940.94
PABPC40.940.93
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.31-0.87-0.91
MT-CO2-0.86-0.91
AF347015.33-0.84-0.89
AF347015.27-0.84-0.90
MT-CYB-0.83-0.89
AF347015.8-0.82-0.90
AF347015.2-0.80-0.89
FXYD1-0.80-0.87
AF347015.15-0.79-0.87
S100B-0.78-0.86

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0003723RNA bindingIEA-
GO:0005515protein bindingIEA-
GO:0004864protein phosphatase inhibitor activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0030528transcription regulator activityIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006350transcriptionIEA-
GO:0006606protein import into nucleusTAS9461602 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusTAS9461602 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
ONKEN UVEAL MELANOMA UP 783507All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP 473314All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE DN 244147All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN 663425All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP 552347All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP 211136All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957597All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734436All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648385All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR DN 4130All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN 337230All SZGR 2.0 genes in this pathway
ZHOU TNF SIGNALING 4HR 5436All SZGR 2.0 genes in this pathway
FUJII YBX1 TARGETS DN 202132All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP 439257All SZGR 2.0 genes in this pathway
SMID BREAST CANCER ERBB2 UP 14783All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 M 216124All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462273All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517302All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-148/1524884951A,m8hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-200bc/4292983051A,m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-34/449822828m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-34b823829m8hsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
miR-376100610131A,m8hsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU
miR-381109611021Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-493-5p176182m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-5395795851Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-93.hd/291-3p/294/295/302/372/373/5204084141Ahsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU