Gene Page: PPP2R2C
Summary ?
| GeneID | 5522 |
| Symbol | PPP2R2C |
| Synonyms | B55-GAMMA|IMYPNO|IMYPNO1|PR52|PR55G |
| Description | protein phosphatase 2 regulatory subunit B, gamma |
| Reference | MIM:605997|HGNC:HGNC:9306|Ensembl:ENSG00000074211|HPRD:09345|Vega:OTTHUMG00000090445 |
| Gene type | protein-coding |
| Map location | 4p16.1 |
| Pascal p-value | 0.135 |
| Sherlock p-value | 0.163 |
| Fetal beta | -1.528 |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Expression | Meta-analysis of gene expression | P value: 1.432 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FXYD7 | 0.56 | 0.56 |
| YPEL3 | 0.56 | 0.57 |
| RFPL2 | 0.56 | 0.57 |
| YPEL4 | 0.55 | 0.59 |
| P4HTM | 0.54 | 0.57 |
| HMOX2 | 0.54 | 0.55 |
| MPI | 0.53 | 0.53 |
| MRPS25 | 0.53 | 0.55 |
| ADC | 0.52 | 0.55 |
| C6orf136 | 0.52 | 0.54 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.18 | -0.31 | -0.16 |
| AF347015.21 | -0.28 | -0.16 |
| MT-ATP8 | -0.27 | -0.12 |
| ANP32C | -0.25 | -0.28 |
| RP11-3P17.1 | -0.25 | -0.26 |
| AF347015.2 | -0.24 | -0.09 |
| IL32 | -0.24 | -0.20 |
| EDN1 | -0.24 | -0.06 |
| CD248 | -0.24 | -0.23 |
| FAM159B | -0.24 | -0.30 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008601 | protein phosphatase type 2A regulator activity | IEA | - | |
| GO:0008601 | protein phosphatase type 2A regulator activity | NAS | 10945473 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0007165 | signal transduction | NAS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000159 | protein phosphatase type 2A complex | IEA | - | |
| GO:0000159 | protein phosphatase type 2A complex | NAS | 10945473 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ARL2 | ARFL2 | ADP-ribosylation factor-like 2 | - | HPRD,BioGRID | 12912990 |
| CCT2 | 99D8.1 | CCT-beta | CCTB | MGC142074 | MGC142076 | PRO1633 | TCP-1-beta | chaperonin containing TCP1, subunit 2 (beta) | Affinity Capture-MS | BioGRID | 18782753 |
| CCT3 | CCT-gamma | CCTG | PIG48 | TCP-1-gamma | TRIC5 | chaperonin containing TCP1, subunit 3 (gamma) | Affinity Capture-MS | BioGRID | 18782753 |
| CCT4 | CCT-DELTA | Cctd | MGC126164 | MGC126165 | SRB | chaperonin containing TCP1, subunit 4 (delta) | Affinity Capture-MS | BioGRID | 18782753 |
| CCT5 | CCT-epsilon | CCTE | KIAA0098 | TCP-1-epsilon | chaperonin containing TCP1, subunit 5 (epsilon) | Affinity Capture-MS | BioGRID | 18782753 |
| CCT6A | CCT-zeta | CCT-zeta-1 | CCT6 | Cctz | HTR3 | MGC126214 | MGC126215 | MoDP-2 | TCP-1-zeta | TCP20 | TCPZ | TTCP20 | chaperonin containing TCP1, subunit 6A (zeta 1) | Affinity Capture-MS | BioGRID | 18782753 |
| CCT7 | CCT-ETA | Ccth | MGC110985 | Nip7-1 | TCP-1-eta | chaperonin containing TCP1, subunit 7 (eta) | Affinity Capture-MS | BioGRID | 18782753 |
| CCT8 | C21orf112 | Cctq | D21S246 | KIAA0002 | PRED71 | chaperonin containing TCP1, subunit 8 (theta) | Affinity Capture-MS | BioGRID | 18782753 |
| PPP2CA | PP2Ac | PP2CA | RP-C | protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform | Affinity Capture-MS | BioGRID | 18782753 |
| PPP2R1A | MGC786 | PR65A | protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform | Affinity Capture-MS | BioGRID | 18782753 |
| PPP2R1B | MGC26454 | PR65B | protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform | Affinity Capture-MS | BioGRID | 18782753 |
| RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | RAF1 (c-Raf) interacts with an unspecified isoform of PPP2R2C (PP2A-C). | BIND | 16041367 |
| TCP1 | CCT-alpha | CCT1 | CCTa | D6S230E | TCP-1-alpha | t-complex 1 | Affinity Capture-MS | BioGRID | 18782753 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CHREBP2 PATHWAY | 42 | 35 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
| WANG ESOPHAGUS CANCER VS NORMAL DN | 101 | 66 | All SZGR 2.0 genes in this pathway |
| PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 AND TP63 TARGETS | 205 | 145 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY DN | 110 | 64 | All SZGR 2.0 genes in this pathway |
| KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
| SAKAI TUMOR INFILTRATING MONOCYTES DN | 81 | 51 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
| HANN RESISTANCE TO BCL2 INHIBITOR UP | 36 | 24 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| FOSTER KDM1A TARGETS UP | 266 | 142 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-194 | 2708 | 2714 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
| miR-200bc/429 | 1870 | 1877 | 1A,m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-218 | 1736 | 1743 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-320 | 2683 | 2689 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
| miR-369-3p | 1872 | 1879 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-374 | 1873 | 1879 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-493-5p | 1879 | 1885 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-505 | 2653 | 2659 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
| miR-543 | 2706 | 2712 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
| hsa-miR-543 | AAACAUUCGCGGUGCACUUCU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.