Summary ?
GeneID55225
SymbolRAVER2
Synonyms-
Descriptionribonucleoprotein, PTB-binding 2
ReferenceMIM:609953|HGNC:HGNC:25577|Ensembl:ENSG00000162437|HPRD:11154|Vega:OTTHUMG00000009102
Gene typeprotein-coding
Map location1p31.3
Pascal p-value0.05
Sherlock p-value0.713
Fetal beta0.462
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.02692 

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs17542055chr742652803RAVER2552250.19trans
rs9508068chr1329153859RAVER2552250.08trans
rs284907chr1576741568RAVER2552250.18trans
rs284904chr1576744301RAVER2552250.12trans
rs284898chr1576750694RAVER2552250.03trans
rs157768chr1576833778RAVER2552250.1trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003723RNA bindingIEA-
GO:0005515protein bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
LIU PROSTATE CANCER DN 481290All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP 269146All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316190All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS DN 14294All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246153All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C 463262All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491319All SZGR 2.0 genes in this pathway
BILANGES SERUM SENSITIVE GENES 9054All SZGR 2.0 genes in this pathway
BILANGES SERUM RESPONSE TRANSLATION 3720All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98129012961Ahsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-124.160671A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/50660661Ahsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-13581871Ahsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-1373223291A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-44822352241m8hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-99/10097103m8hsa-miR-99abrainAACCCGUAGAUCCGAUCUUGUG
hsa-miR-100brainAACCCGUAGAUCCGAACUUGUG
hsa-miR-99bbrainCACCCGUAGAACCGACCUUGCG