SZGR2

Summary ?

GeneID	5530
Symbol	PPP3CA
Synonyms	CALN\|CALNA\|CALNA1\|CCN1\|CNA1\|PPP2B
Description	protein phosphatase 3 catalytic subunit alpha
Reference	MIM:114105\|HGNC:HGNC:9314\|Ensembl:ENSG00000138814\|HPRD:00234\|Vega:OTTHUMG00000133839
Gene type	protein-coding
Map location	4q24
Pascal p-value	0.018
Sherlock p-value	0.696
Fetal beta	-1.544
Support	INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_TAP-PSD-95-CORE G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 6.0623

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TMF1	0.94	0.95
PIK3C3	0.94	0.93
POLK	0.93	0.95
APPBP2	0.93	0.93
CUL4B	0.92	0.94
IPO7	0.92	0.94
TTC21B	0.92	0.93
API5L1	0.92	0.92
KIAA1012	0.92	0.93
ZBTB11	0.91	0.93

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.69	-0.74
FXYD1	-0.68	-0.74
AF347015.31	-0.68	-0.73
HIGD1B	-0.67	-0.74
IFI27	-0.67	-0.74
AF347015.21	-0.66	-0.71
MT-CYB	-0.65	-0.70
CST3	-0.65	-0.73
CXCL14	-0.65	-0.72
AF347015.8	-0.65	-0.71

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005506	iron ion binding	IEA		-
GO:0005509	calcium ion binding	NAS		8392375
GO:0005516	calmodulin binding	NAS		8392375
GO:0004722	protein serine/threonine phosphatase activity	NAS		8392375
GO:0016787	hydrolase activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0050804	regulation of synaptic transmission	IEA	neuron, Synap (GO term level: 7)	-
GO:0000082	G1/S transition of mitotic cell cycle	IEA		-
GO:0006470	protein amino acid dephosphorylation	NAS		8392375
GO:0006950	response to stress	IEA		-
GO:0006606	protein import into nucleus	IEA		-
GO:0006816	calcium ion transport	IEA		-
GO:0048741	skeletal muscle fiber development	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0030018	Z disc	IEA		-
GO:0005955	calcineurin complex	NAS		8392375

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ADRB2	ADRB2R \| ADRBR \| B2AR \| BAR \| BETA2AR	adrenergic, beta-2-, receptor, surface	Co-fractionation	BioGRID	9880537
AKAP5	AKAP75 \| AKAP79 \| H21	A kinase (PRKA) anchor protein 5	-	HPRD,BioGRID	7528941 \|9765270
BCL2	Bcl-2	B-cell CLL/lymphoma 2	-	HPRD,BioGRID	7593193 \|9109491
C16orf74	MGC17624	chromosome 16 open reading frame 74	Two-hybrid	BioGRID	16189514
CABIN1	CAIN \| KIAA0330 \| PPP3IN	calcineurin binding protein 1	Two-hybrid	BioGRID	9655484
CABIN1	CAIN \| KIAA0330 \| PPP3IN	calcineurin binding protein 1	-	HPRD	11714752
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	-	HPRD	11478781
CRTC2	RP11-422P24.6 \| TORC2	CREB regulated transcription coactivator 2	TORC2 interacts with CnA.	BIND	15454081
FKBP1A	FKBP-12 \| FKBP1 \| FKBP12 \| FKBP12C \| PKC12 \| PKCI2 \| PPIASE	FK506 binding protein 1A, 12kDa	-	HPRD	7543369
FKBP8	FKBP38 \| FKBPr38	FK506 binding protein 8, 38kDa	-	HPRD	12510191
MYOZ1	CS-2 \| FATZ \| MYOZ	myozenin 1	Affinity Capture-Western	BioGRID	11114196
MYOZ2	C4orf5 \| CS-1	myozenin 2	Affinity Capture-Western	BioGRID	11114196
MYOZ2	C4orf5 \| CS-1	myozenin 2	-	HPRD	11842093
MYOZ3	CS-3 \| CS3 \| FRP3	myozenin 3	-	HPRD	11842093
PPIA	CYPA \| CYPH \| MGC117158 \| MGC12404 \| MGC23397	peptidylprolyl isomerase A (cyclophilin A)	-	HPRD,BioGRID	12218175
PRKCZ	PKC-ZETA \| PKC2	protein kinase C, zeta	-	HPRD	12021260
RCAN1	ADAPT78 \| CSP1 \| DSC1 \| DSCR1 \| MCIP1 \| RCN1	regulator of calcineurin 1	-	HPRD,BioGRID	10861295
RCAN2	CSP2 \| DSCR1L1 \| MCIP2 \| RCN2 \| ZAKI-4 \| ZAKI4 \| hRCN2	regulator of calcineurin 2	Reconstituted Complex	BioGRID	12102656
SOD1	ALS \| ALS1 \| IPOA \| SOD \| homodimer	superoxide dismutase 1, soluble	-	HPRD	11513882

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG OOCYTE MEIOSIS	114	79	All SZGR 2.0 genes in this pathway
KEGG APOPTOSIS	88	62	All SZGR 2.0 genes in this pathway
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
KEGG VEGF SIGNALING PATHWAY	76	53	All SZGR 2.0 genes in this pathway
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY	137	92	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG B CELL RECEPTOR SIGNALING PATHWAY	75	56	All SZGR 2.0 genes in this pathway
KEGG LONG TERM POTENTIATION	70	57	All SZGR 2.0 genes in this pathway
KEGG ALZHEIMERS DISEASE	169	110	All SZGR 2.0 genes in this pathway
KEGG AMYOTROPHIC LATERAL SCLEROSIS ALS	53	43	All SZGR 2.0 genes in this pathway
BIOCARTA BCR PATHWAY	37	28	All SZGR 2.0 genes in this pathway
BIOCARTA HDAC PATHWAY	32	25	All SZGR 2.0 genes in this pathway
BIOCARTA CALCINEURIN PATHWAY	21	17	All SZGR 2.0 genes in this pathway
BIOCARTA NDKDYNAMIN PATHWAY	21	15	All SZGR 2.0 genes in this pathway
BIOCARTA FCER1 PATHWAY	41	30	All SZGR 2.0 genes in this pathway
BIOCARTA FMLP PATHWAY	39	29	All SZGR 2.0 genes in this pathway
BIOCARTA VIP PATHWAY	29	26	All SZGR 2.0 genes in this pathway
BIOCARTA NFAT PATHWAY	56	45	All SZGR 2.0 genes in this pathway
BIOCARTA NOS1 PATHWAY	24	21	All SZGR 2.0 genes in this pathway
BIOCARTA CK1 PATHWAY	17	17	All SZGR 2.0 genes in this pathway
BIOCARTA PGC1A PATHWAY	26	20	All SZGR 2.0 genes in this pathway
BIOCARTA MEF2D PATHWAY	23	16	All SZGR 2.0 genes in this pathway
BIOCARTA GPCR PATHWAY	37	31	All SZGR 2.0 genes in this pathway
BIOCARTA TCR PATHWAY	49	37	All SZGR 2.0 genes in this pathway
SIG BCR SIGNALING PATHWAY	46	38	All SZGR 2.0 genes in this pathway
PID BCR 5PATHWAY	65	50	All SZGR 2.0 genes in this pathway
PID IL12 2PATHWAY	63	54	All SZGR 2.0 genes in this pathway
PID NFAT 3PATHWAY	54	47	All SZGR 2.0 genes in this pathway
PID CMYB PATHWAY	84	61	All SZGR 2.0 genes in this pathway
PID TCR CALCIUM PATHWAY	29	23	All SZGR 2.0 genes in this pathway
PID CD8 TCR DOWNSTREAM PATHWAY	65	56	All SZGR 2.0 genes in this pathway
PID IL12 STAT4 PATHWAY	33	29	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME OPIOID SIGNALLING	78	56	All SZGR 2.0 genes in this pathway
REACTOME DARPP 32 EVENTS	25	20	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 DN	267	178	All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER UP	96	57	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP	579	346	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP	164	122	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP	162	116	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 324 UP	150	93	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN	394	258	All SZGR 2.0 genes in this pathway
JOHANSSON GLIOMAGENESIS BY PDGFB DN	21	16	All SZGR 2.0 genes in this pathway
LANG MYB FAMILY TARGETS	29	16	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
DER IFN ALPHA RESPONSE UP	74	48	All SZGR 2.0 genes in this pathway
KENNY CTNNB1 TARGETS DN	52	34	All SZGR 2.0 genes in this pathway
DER IFN BETA RESPONSE UP	102	67	All SZGR 2.0 genes in this pathway
SANA RESPONSE TO IFNG UP	78	50	All SZGR 2.0 genes in this pathway
DER IFN GAMMA RESPONSE UP	71	45	All SZGR 2.0 genes in this pathway
XU RESPONSE TO TRETINOIN DN	13	8	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C8	72	56	All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS POSTNATAL	63	50	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS DN	74	55	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH	60	42	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN	165	106	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS DN	314	188	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION	88	65	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP	226	164	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER UP	20	14	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 1 DN	63	39	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
GUO TARGETS OF IRS1 AND IRS2	98	67	All SZGR 2.0 genes in this pathway
CHEMELLO SOLEUS VS EDL MYOFIBERS DN	19	10	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	638	644	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-103/107	68	74	1A	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	68	74	1A	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-142-3p	1411	1417	1A	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-142-5p	1029	1036	1A,m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-145	736	743	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-145	736	743	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-153	925	931	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-17-5p/20/93.mr/106/519.d	2048	2054	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-186	648	654	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-208	541	547	1A	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-21	1129	1135	m8	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	1129	1135	m8	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-30-3p	1346	1352	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	1346	1352	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-30-5p	412	418	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
				hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-31	92	98	m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-330	1083	1089	1A	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-34b	921	927	1A	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-378*	1365	1371	m8	hsa-miR-422b	CUGGACUUGGAGUCAGAAGGCC
miR-378*	1365	1371	m8	hsa-miR-422a	CUGGACUUAGGGUCAGAAGGCC
miR-381	1312	1318	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-495	2019	2025	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-499	540	547	1A,m8	hsa-miR-499	UUAAGACUUGCAGUGAUGUUUAA
miR-543	292	298	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PPP3CA