Gene Page: PREP
Summary ?
| GeneID | 5550 |
| Symbol | PREP |
| Synonyms | PE|PEP |
| Description | prolyl endopeptidase |
| Reference | MIM:600400|HGNC:HGNC:9358|Ensembl:ENSG00000085377|HPRD:02673|Vega:OTTHUMG00000015297 |
| Gene type | protein-coding |
| Map location | 6q22 |
| Pascal p-value | 0.113 |
| Sherlock p-value | 0.144 |
| Fetal beta | -0.035 |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RASAL1 | 0.86 | 0.86 |
| TMEM130 | 0.86 | 0.89 |
| CPNE6 | 0.86 | 0.89 |
| SUSD4 | 0.86 | 0.87 |
| MINK1 | 0.84 | 0.80 |
| MAP2K1 | 0.84 | 0.85 |
| AP001107.1 | 0.83 | 0.87 |
| PTPRN | 0.82 | 0.89 |
| ZNF831 | 0.81 | 0.78 |
| TTC7B | 0.81 | 0.87 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RBMX2 | -0.50 | -0.60 |
| BCL7C | -0.49 | -0.60 |
| TUBB2B | -0.49 | -0.48 |
| KIAA1949 | -0.49 | -0.37 |
| TRAF4 | -0.49 | -0.53 |
| SH3BP2 | -0.47 | -0.51 |
| RPL23A | -0.47 | -0.54 |
| DYNLT1 | -0.47 | -0.57 |
| CARHSP1 | -0.47 | -0.53 |
| EXOSC8 | -0.47 | -0.45 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
| GO:0004252 | serine-type endopeptidase activity | TAS | glutamate (GO term level: 7) | 9695945 |
| GO:0008233 | peptidase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006508 | proteolysis | IEA | - | |
| GO:0006508 | proteolysis | TAS | 9695945 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005737 | cytoplasm | TAS | 9695945 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
| BOGNI TREATMENT RELATED MYELOID LEUKEMIA DN | 33 | 19 | All SZGR 2.0 genes in this pathway |
| WAMUNYOKOLI OVARIAN CANCER LMP UP | 265 | 158 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
| SCIAN INVERSED TARGETS OF TP53 AND TP73 DN | 31 | 23 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| MORI IMMATURE B LYMPHOCYTE DN | 90 | 55 | All SZGR 2.0 genes in this pathway |
| MORI MATURE B LYMPHOCYTE DN | 75 | 43 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| JIANG AGING CEREBRAL CORTEX UP | 36 | 27 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| SESTO RESPONSE TO UV C4 | 20 | 14 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
| JIANG AGING HYPOTHALAMUS UP | 47 | 31 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
| DANG MYC TARGETS UP | 143 | 100 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 | 143 | 86 | All SZGR 2.0 genes in this pathway |
| RAMPON ENRICHED LEARNING ENVIRONMENT EARLY DN | 10 | 10 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-455 | 212 | 218 | m8 | hsa-miR-455 | UAUGUGCCUUUGGACUACAUCG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.