Summary ?
GeneID55670
SymbolPEX26
SynonymsPBD7A|PBD7B|PEX26M1T|Pex26pM1T
Descriptionperoxisomal biogenesis factor 26
ReferenceMIM:608666|HGNC:HGNC:22965|Ensembl:ENSG00000215193|HPRD:10559|
Gene typeprotein-coding
Map location22q11.21
Pascal p-value0.13
Fetal beta-0.37
DMG1 (# studies)
eGeneMeta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_IGenome scan meta-analysisPsr: 0.031 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg162817962218560863PEX267.11E-8-0.0091.71E-5DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
WDR190.830.88
C20orf960.830.85
DNAH100.830.87
PROM10.820.77
AADAT0.820.79
TBCCD10.810.87
EXOSC100.810.86
TOR1B0.810.87
DISP10.810.83
RAGE0.800.83
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.31-0.64-0.83
MT-CO2-0.63-0.82
HLA-F-0.63-0.71
AF347015.27-0.62-0.80
AF347015.33-0.62-0.81
AIFM3-0.61-0.71
MT-CYB-0.60-0.80
C5orf53-0.60-0.70
AF347015.8-0.59-0.81
S100B-0.59-0.74

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0008022protein C-terminus bindingIPI15713480 
GO:0032403protein complex bindingIDA16854980 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016558protein import into peroxisome matrixIMP15858711 
GO:0015031protein transportIEA-
GO:0045046protein import into peroxisome membraneIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005777peroxisomeIDA15858711 
GO:0005778peroxisomal membraneIEA-
GO:0005779integral to peroxisomal membraneIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG PEROXISOME 7847All SZGR 2.0 genes in this pathway
GRABARCZYK BCL11B TARGETS UP 8140All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142669All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL 311205All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS UP 388234All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS 535325All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-3p123312391Ahsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC